Transcript Name :
Hyaar_Emoy2800005
Orientation:
(+)
Number of Exons:
2
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutaredoxin9.325PS51354
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-133
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        498 bases(100 bases per row)
ATGGTCTCCATTACCGAGCAAAAGTACGAAATTGGCCACCTCAAGCAGCTGCTCGATGGCAACAAGATTGCGTATACGGAAGTGGACTGCAGTCTCGAGG
AGAACCGAGAGACGCGAGACCGCTACTTTGAGGCGAGTGGTATTCGTGCCAACTACCCGCAGGTGTTTCTACAGGACCCGCAAGGCAAGAAGATCCAGTA
CATTGGCTCGTTCAAGGAAATTCAAGTGCGTGGCACGCTGTGTAATGGTGGTACAAATGTTGGTGGATTGTCAACTGATTTCTGTGGTGGACCCTTCTCT
CTCTTTCTTGTGTCTGGGTAGGAGCTGAACGAGATGAACGATGTGCCGCCAGAGATTCTCAAGGCCAACAACATCCAGACGCTCAAAAGCGTCTTTGCTG
GTACTTTTCGCGTTGTTTATGGTGCTGGAGTCGATCGTGTGTTGCTCATTCTTTGTTGTGTTGTCTTTGTGCGGCTAGACGTGTTGAAACGAGCTTGA