Transcript Name :
Hyaar_Emoy2800004
Orientation:
(-)
Number of Exons:
1
Description :
serine/threonine protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
RWD domain14.01PS50908
Protein kinase domain37.262PS50011
HmmSmart predictionP-Valprediction_id
Serine/threonine- / dual specificity protein kinase, catalytic domain4.6SM00220
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-785
*** None ***
*** None ***
TypeScore
cytoplasmic435
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein bindingGO:0005515IEA
protein phosphorylationGO:0006468IEA
*** None ***
Cluster Id
1076
Sequence
        2358 bases(100 bases per row)
ATGCAGAGCGCGACGCCTTTGTATACGTATATTTTCACCATTCGATTGCGATGCGAGGTCACGACTGGATCAGCGACAACGTCAGAAGTACTGCTACATT
TTGACTTTACGCGACTGTACCCAATTAAAGAACCGCCTATTGTCATGGTGGAAGCCAAGCACGGACTCTCGGACAGCGAGACGCAGAAATTGATGGACCA
AATGGAGAAATATGCACTGGAAAAAATCGGTGACCCGGTCGTGTACGACCTCGTGGTGTTTGCCACGGACTTTATCATGGATCGTCTGTCCGACCAATCG
TCGTTCTTTGACCAGATGGTCACTCGACAGCAGGATCGAGATGCGCAAAAGAAGTTGACAGACGACGCACTGCTGCAACAACAAGAGGAACACGTTCGAG
CAAAAAATGAGGCAATATTAGCGCTTCTGGATACCGAACGGAAGAAGCGAGAGGCGTTGGAAAAGAAGACGCGGCGAGGGCGAAGGAGACACCAATTTGA
GGATTGGGATGAACATGCGAGTGGCAGCGATGGTGCTAAAAGTCGAGACGACGTGGCAAGTCCATCGTGCGTATACGATCAGCTATCGGAGACGAGTTCC
AAGTGGAATTCTTGTGTGTCGGACTCTGACGCATCGGACTTGGACGCGATTGCGGCATCAGAACGGTACCATTCCAGATACCTTGGTGATTTCAAAGAGC
TGGGGTTGCTGGGACGTGGAGGAGGTGGCGAAGTGGTGAAGGTCCGTAATCGGCTGGACCGACAAATGTACGCGGTGAAGAAGGTTAAAGTGGACCCAAA
CGACAAGACGATGAAGAAGAAGATTTTGCGTGAAGTGAAGACTATTTCGCGAATGCAGCACCGACACATTGTGCGGTATTTCCAGGCATGGATAGAAGGT
GAGCATGGAATGTCTTCTGACGATGAAGGAAATTCTAGTCTAGAGGATAGCGACTTCAGTGAAGGAGAAGACTTGTCGGGCAGCCTTGTCGTTGGTGAAA
AAGATTGTCTGGGTGGCGCAGCGAGTTTCTCGTCGGATGTCGACGATAGGTTGGAGCCAATGACGTCGACAGATGAAGACGAAGACGACTGGCTAGGCGC
CATGAGCAGCAGTATAGGGCTACGGGCGACTTCAACGTCTTGTCACGATTCCCGAAGCCTGCGTAGTAAGAGTCGCTTGTTTCAGCTTTCTTCGCAGCAT
TCGGTGGTCGAGGGCTACCCTGATGGTGATTCTGAGTGGGAAGCGTTGGAAGAAGCTCCAGAAGACGAGGTTGACCTTATAAGTGATAAAGATGGTGGAA
GTGACCGAGAGACACTGCTTCATGAAAATCCTGTACTCAAGAAGAAGAGGAAGTTTGAGAAATTATTTATACAGATGGAATTCTGCGAGGGAAATGCTCT
ACGAGAGGTGATTGACAAAGGAGCTTTATGGAAGGATCCTGATAGAATTTGGACGATGTTTCGACAAATCTTGGAGGCACTTGTGTACATTCACAGTCAG
GGGATTATTCACCGAGATATTAAGCCACCGAATGTCTTTCTGGACTCGGAGGGGACTATAAAGCTAGGGGATTTTGGTCTCGCCGTTCGGCCTCCCAAGG
TAACAGAAGATGACGGCAGCAACAGCGGCTCTTCACCATCCGGAGAAACTGCTACTGGCGCAATGTTATCGGAGTTCGCTGGATCATCTGTTGCCGAGCT
GTATGGGCGTCTCAAGCTGGAGACATTGGAAGACACAAGAGTTGATGGCCCACCGAGTGAACAGCAGTATAGCAACCTGATGACGGCCATGTCGGCGGAC
GTGATTGACGGCAGTATCACTGCTGGTGTCGGTACTGCATTCTATCGGGCGCCTGAGCAAGAGAGAGAAGGACAGCGATATAATCAGAAAGCAGATCTGT
TCTCTCTCGGCATTATGCTCTTCGAAATGTGGTCACCGCCGTTTACGACCCTGATGGAGCGAGCACAGGCACTTGTTGGACTAAGAGAAAGGCACGAGTT
ACCAGAATCATTTTGTGCGTCTGATGTCGTGAGAAAGATAATTCTATGGCTTTGCGAACATGATCCATCAAGGCGGCCGAATGCAAAGGAGCTCATAGTG
AGTCCATTACTGCCTGCAAAGATTGAGATCGAGGGATCCTATCTGCGAGAGGCTTTGAAAACGCTCGCGAATCCACAAGGCAAATGTTTTCGCCAGCTGA
TTGAAGCTCTGGTGTCACAGGCACCTCTCAATCACGTCGACTATACCTACGATCACGTGGAGTCGGTCAAAATGCGCAGCTACGAGGTCCACCTACGCAC
AAAAACATACGTCAGGAGCCTGCTACAGGTTTGTTGTCATTTGATCACAGTAGCATAG