Transcript Name :
Hyaar_Emoy2800013
Orientation:
(+)
Number of Exons:
1
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
36-91
197-326
387-415
508-513
1-12
115-173
350-363
439-484
537-553
13-35
92-114
174-196
327-349
364-386
416-438
485-507
514-536
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1662 bases(100 bases per row)
ATGTTAGAATGCACGCACTACCTCTCACATCCAGTCATGACCTCGTCCTCCGCAGCACTGCTATTTACAACATGCTTGTACATCTGCACCTCTTCACTAG
CACTTGATGCCAACGACTCATTGTTGCTGAACATCGAGTCAAACGTAACATGCGAAGATTCTCCTGATTGTCTGGCAAAGGGTCTAGAGCACAATACGTG
TCGTGGTGGCATCTGTGTGACCGATGCGCTGTTTCCTCTATCTCGAGCGGATATCGCTGGCTCCGTTGGTGGTTTCATAGCAACTGCCTTAGCTGCTGGT
TCTGGATTGGGTGGTGGTGGGCTCCTTGTCCCTGTATACATTCTACTAATGAGCCTGTCGTCCCACGAGGCAGTGCCACTGTCTAAGGCCACAATCTTTG
GTGGCGCGATTGCCAGCATTTTGGTCAACGTCCGGAAGCGTCATCCATTGGTGCACAGCCGTCCGCTGATTGATTATGAGACAATCCTGCTCATGGAGCC
TTTGACGTTAGCTGGCACGATCATCGGGGTCAATATGAACACGGTCTTTCCGGAATGGCTCATTACGATTTGTATTGTGTGGCTTTTGGTCAAAACGGCC
TGTCGTACATACAGAAAGGGCAAGAAAGTGTGGAAAGAAGAGGCGGATGTGGACCGCAAGGTCGTGGCGGACATTTTAGCGTACTGGCGGTTACTGCCGT
ATGAGTCGAATTTCAGGCAGTTCCAAGTGACAGCACGCGCATACTTAAAGTGGAAGACATACAAGTCGCTGGACAGAGCGGAATTTCAGCTGAAGATCGT
GAGTGCTAAAGTCTGTCGTGAGGAACATTGCAGCTTTTCAAATAGCACTGAGACGAGCACAGAAGACGAAGAAGCGAGCAGCGACGGTGATGAACATGGA
CCGGCGATGGCGTGGGGGCTCCAGGACAATCGGGCAGTGAAGTTCGTCTCAGTGAAAGACATCGCCAAAGCGCGACGCGCTGTCCCACTGGCAGATATGG
GCGTGCTGTTCCTGACGTGGATCGGACTTGTACTGTTTTCTATGGCCAAAGGTGGACACGATACGCCTAGCGTTATCGGGTTGTCATGTGGCAGCGCTGG
TTACTGGCTGCTCACTATCGCTTCGTTCCCATTCTTCGTAAGCGTGACGATCTACTTCGGTATGAAGATCAGCCGGTTTCACACGATGCTGCAGGCTTCC
GACTACACATATGCCAAGGGCGACATGGTGTGGACGAAACAAGCAGTGATTAAGTACCCTGCGCTGTGCACTGCCGCTGGCATAGCTGCTGGTCTGCTAG
GTATTGGAGGCGGCATGGTAAAAGGTCCATTGCTGATTGAAATGGGACTGCTACCACAAGTGTCCTCGGCAACGTCGTCGTCGATGATCCTGTTTACATC
TTCTGCCACCACTATCCAGTTTATCATTCTAGGCACGTTGCCAGTGGACCACGCACTATGGCATGGCGTCATCGGGTTTGCCGCCGGTCTCGTTGGGCAG
CTGGGGATGTCGTATCTTGTCAAGAAGTACCGCAAATCGGCGCTCGTAATCTTTTTCGTGGCTGGTTTCATCGGAATCAGTGGCCTCGTTATGGGTGTGC
TAGGCGTTGTCCGCACTTCAAAAATCGGCTTTGGCGGGTTTCGGTCGCTTTGTCTCGGTTAA