Transcript Name :
Hyaar_Emoy2800032
Orientation:
(+)
Number of Exons:
4
Description :
pro-apoptotic serine protease nma111-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
PDZ domain7.3SM00228
PDZ domain1.3SM00228
PDZ domain2.4SM00228
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-931
*** None ***
*** None ***
TypeScore
nuclear348
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
254
Sequence
        3427 bases(100 bases per row)
ATGCCTACTGCGGGTCTAGCGCGATCTTATTTTGCTCGGTCCTCTTCGACACCAGGTATTTGGTCTGGTATAAAACGATGGGTGATTGGGTTAAAGTGAC
GCTATCGATGTGTCGATTTGGGTTTTTCATTTATAGCGACGCAAAGAAAAGCACAAGTGGTGGCAGCAGCACTGGCAACAGCTGGCGCTGCTTACCTGTA
CACGACGACTGAGCGTCAGAGCAAGGAGGAGAAACAGCAGCGTGAGCTAGAGATTGAGAAGGAGCGGAAGCTTAGCAGTCGACTGGCAGCAGAGCTCGTA
GCAGCTGAAGCCAATCAGAACAAACTGGACTGGAAGGCCACGCTTGAGCGTGTCGTGCCGGCGATTGTGTCGCTGAAGCTTAATTCGCCTAAGGTGGGTG
AATGGGTGAAATGTTGTTGCGTGGTGGTGCAGTGATTGCTAAAAGTGGGTGTTTTTTCTACTTTGGGTTTTATAGTTCTTTGACACCGAGTCACCAGGCA
ATGGATCGGCCACGGGCTTTGTGGTAGATGCTGAGAAGGGGATTATTCTGACCAATCGACATGTTGTAGGGCCAGGACCGATTGTACGATCGATGGAAAT
GTTGTTGTTCTTTTTAATGTTAGTAAAGGGTCGTGATTGTTTGACGATACGCTGTCGAAACTTGCAGGATGCGGAGGCTGTTTTCCATAACAATGAGGAA
GTGCGAGTGATTCCCATTTATCGGGACCCAGTTCATGATTTTGGTTTCTTTCAATTTAACCCAGCGGTAGGTAGTTGTGTATTGTGTTCATATGTGTGAC
TGGCAGCGAACAGTCACTGATTGATTTTCTTACTGATGAATAGGACGTAAATCACATGTCAGTGCCGTCCCTGCGTTTACAGCCGGAGAAAGCTACCGTT
GGAACAGATATTCGAGTCGTGGGAAACGATGCTGCTGAGAAACTCGCTATTGCTAGCGGTACGCTGGCGCGCCTGGATCGCGACGCACCCAACTACGGAT
TTAACAGCTACAACGACTTCAATACGTTTTACTACCAAGCATCGTCAGGAACAACCGGGGGCTCTTCTGGTTCACCTGTACTCAACCATGATGGCGACGT
AATCGCTCTCAATGCCGGTGGCAAGATCGGCACAGCAGCGTCCTTCTATCTACCATTATATCGAGCCAAACGGGCGTTTGATTTAGTTCGGGAAGGTAAG
GACGTTCCCCGCGGCACTATCCAGACCATTTTCAACTACAAGCCTTTCGACGAGGTGCGTCGACTCGGTGTAGACAGCGCTACAGAAGCGCTTGTGCGCT
CATCTTTTCCGCTAGAGATAGGAATGCTGACAGTAGCAGAAACAATTCCGGATGGCCCATCGAGCAATAAGCTTCAACCAGGTGACGTGTTAGTACGAGT
CAACGGCGAGTTGATCACTCGATTTGTACCGCTTGAAGCGATTCTCGACGATAATGTGGGCAAAGAGGTAGGTGTCTGTCAATATCGACAACATGACATG
GAGTTATATGGCTCATAAGTACCTTTGAGTTCGTCATTAGGTGGAGCTCGAAGTCGAGCGTTCTGGGAAGCCGGTCACGTACAAGGTACAGGTACAAGAC
TTGCACTCGATCACTCCATCACGCTTCGTGGAGATCGGTGGGGCAGTCATAAACCCGCTGTCGTACCAGCAAGCGCGGAATCATGCAATGAGTCCTGGAG
CACCGTACGTCGCGGACCCAGGTTACTTTCTCCAGCGTTCGCGCATCGAACGTGGTGCCATCATCCACTCGGTGAATGGTATCAAGACACCTGATCTTGA
GACGCTCAAGAACTATCTGAAGCAATGCGGGGACCGTGATCGCGTCGTGGTGAAATTCTCTAAATTGACGGATAAGTCGGAGAAGGTTGAGGTTGTGCAT
GTGGATCGCAGGTGGTTCTTGTTCTGTGAGTGCGTGCGCGATGACAAGCTCGGAACGTGGCATTGCGAACAGTTTTTGCCGCCGGCCGACAAAAGCAATG
ATGGCAATGGCACGGATGCAGCCGATGAGAAGCCAGTCGGCTCAACAACAACCTTGCCGGGCAAAAACCCGGTGGAAAATAAGCTTGCGCGATCTTTGGT
GACAGTGGACTTTGATAGACCGTTCAGCGTGAACAGTTTGTCAATGTCGAATTACCGTGGCACAGGACTTGTGATCGATGCAAAGAAGGGGCTTGTAGTT
GTAGACCGCAACACTGTGACTGACTCAATGGGCGATGCCATGGTGACCTTCGCCAGCACTATCATGGTTCCTGCCCAAGTGGTGTTCGTCCACCCGGTGC
ACAATTTTGCGATTGTACAGTACGACCCGAAGCTGATCGGATCGACACCCATTGAGAGCTGCCAAGTGGCAACAAAACCACTTGCACCATCCGATTCGGT
GTGGCTAGTGGGTCTCATGAGTAGTGTGGGGCGTAGCGGCCACTCTGATCTTGTGTCCCGCGAGACAATCGTGTCTGGTGTTAAGTGGATTGGGTTACCG
ATGCCAAATCCACCACGGTACCAGGAACATAATCTGGAAATGGTATCGCTGCAGGATGTTGTTGGCACTGAAGGTGGCGTCATTTGCAGTGACGTGGGTG
AGGTAAGCGCGTTTTGGGCATCTTTTTCTTTCCAGCAGCAGCGTCGTAATTCAAAAGTGGAAAGTCAGTTCAGCCGCGGTATCCCGATGGATATTATCAT
GGAAAGCGCGGCGCCGCTCATGCGTGGAGTGACACCCAAAATCTACGACCTTGGTGTTGATTTTGAGCACTTAAGTTTGGCTAAGGCTCGCGAGCTTGGA
CTTGGACAAGCTTTAGCCGAGATTCTAGAAAAGGACGCGCCGGATCACCGCACCATCCTGAGTGTAGCCCGTCGATGGGGTGGCACCGAGGCACAGACGG
TGCTGAAGAATGGGGACATTCTAGTTGCGGTGGACGGCAAGATTGTGACAAGTTTCCGTGAAGTAGAACGTTGTACACAGAAGCCAGAGGTGGAGCTCAC
GGTCGTGCGCGATGGTCGCGAGATGCAACTGGACGTGAAGACTTTGTTCATGGAGCGCACGGAGATTAACCGCATTGTGTTTTGGCAAGGTTTGTTACTG
CAAGCGCCTCCATTGTCTGTCTCGGCGCAGCGCAGCATCTCGTTGGACGACGGCATTTATGTGTCTTGTCGATACTCGGGCTCTCCAGCTGCTCGTTATG
GCCCACCGCCTACGAGTCGCATCAAGGAAATCGATGGTATAAAGATCACCAGTATCGACGACTTTCTGAGCGTCGTAACGTCGAAATCTACGAACGACTC
GGTGCGCATCAAGTACACCGACCTGAGCGGGAAGGACCGTCTCAGCACACTTAAGCTCGAACCCAAGTACTGGCCTACGAGTGAGTTGGTGAACGAGGAT
GGTGAATGGCGTCGGCGTCAACACTAG