Transcript Name :
Hyaar_Emoy2800017
Orientation:
(+)
Number of Exons:
4
Description :
DEAD/DEAH box RNA helicase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain19.601PS51192
Helicase, C-terminal14.936PS51194
HmmSmart predictionP-Valprediction_id
Helicase, superfamily 1/2, ATP-binding domain1SM00487
Helicase, C-terminal1.5SM00490
Helicase-associated domain2.8SM00847
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Helicase, superfamily 1/2, ATP-binding domainIPR014001
*** None ***
InsideOutsideTMhelix
1-19
39-828
20-38
NN-scoreoddsWeighted Score
0.5151.2020.002
*** None ***
TypeScore
nuclear304
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
nucleic acid bindingGO:0003676IEA
helicase activityGO:0004386IEA
*** None ***
Cluster Id
68
Sequence
        2958 bases(100 bases per row)
ATGGAAGAGTTGGATGTATCGACGGTGCGCGACGTGGAAGACATCCTCATTGACACCATTTACTCGGTACGGGATACGCTGTTTGTTTTTGGGTGTCGGG
AGCTCGTGTCTTTCCAGGTGGTTACTGTGTTGTGTTTGTTTGTTTGTTTGTTATTGCCGGGCGGCCGCTGCCAGGGATTAATTCAAGGCAAGCTGGACCA
GAAGTTACGCTGCTTTGTTGTCAAGTATGCTGTCGGACGCGACACGCATGACGAAGGTGTGGACGAGATGATCGAGAAGCTCATCAGCTGGAAAAAGCAG
TCGGCGAATATGTACGGGAAGATCGGTACAATTCTCAGGTATGCGCTATTATCAGCTAATGTGTGTAGTCGGACTTTACCTAACGCGCTGCTACTTGCCG
GCCCAGCCTGGCGGAGAAACAAGAGCAAGAAGAAAAGGCCCACGAAGAGAGTATGCGCGCCAAGATGGAAGCTCGCGCAGGTGAGCGTGGCAAGGGCTTT
GCATCTGGTAGTACGAACTTTCGTCAAGGCGACGATTTCAGTCATTACGCAGACTCTGCAAGTCGACGAGGGTACGTTATTCACCATTTCATGCTCAATG
TATACATGTATATTATTGCGACACGAACCGACTAACGACGTCGTATGTTGTCAGCGCACCATCCAAGTCGCATCTACACACGATGGGTCGCAAAGGCCGA
ATGTAATCAGAGCCTCCGTTTTGCCGCTTCTTCGAGACGTTTGACCGCTCTTTGAGCAGTTGAAACGCTTTAATACTCAGTTTAAACGCTGGTAATTCAA
CCAATTTAATGTGGACGACCCGACTTTTTCACATCCCCAGCCAATCGTCGATCGGTCCGTCCAGCTCATCAAACCGCTGGTCATGACCAATTCCAGCTAT
AGCTCTGGAACTCCCCGGAAGCGTCCAATTCAGGCGTCAGGTCTGAGCTATAAACACCACAAGAAGCACCATGAGCAACAGCAGCAACGTCACGTCAATC
CAGCTGTTGCCGAATTGCAGCGCACCCGTCAGCGGCTCCCTATTTACGCGCACCGCTCTACAATCATCGAGGCCGTCACGAGCAATCAAGTGATCATTCT
CGTGGGCGAAACGGGAAGTGGCAAGACGACGCAGATCCCGCAGTATATATGGGAAAATGACCGGGTTCATGTTCGTGTAGCCATCACGCAACCACGTCGC
GTGGCAGCTATTACAGTGGCTCAACGCGTGTGCGAGGAGGCGAATCGAGGTCCTCTGGGCGGCAGTGTTGGCTACTGCGTTCGATTCGATGATACTACGT
CCACGAACACACGACTCAAGTTCATGACGGATGGGATGTTGGTGCGAGAAGCGCTGCTCTCGCCAACGCTCGAGAGGTACTCGGTTATCGTGCTGGACGA
AGCTCATGAACGGACGTTGCAGACGGACATTTTGTTTGGGATCGTGAAGCGTGCGATGGTCAAACGCAAGGACCTCAAGGTCGTTGTCATGTCTGCTACG
CTGGACGTGGCACTGTTCCGGAACTTTTTTGAATCTTTCAAGCCCTCGGTGCTTCAAATTCCTGGACGGATGTTCCAGGTCGATGTGTTTTATACAGCAA
AGACGCAGCCGGACTACCTCGATTCGGCGTTAGTGGCTGTGTTGCAGATCCACTTGCAGGAGAAGATGGTGAATGGCAGTATCTTGGTGTTCTTGACAGG
TCAGGAAGATATTGAAACGCTCGAGACGCTACTGGAAGAGTATGCTCGGTCGTTACCACCTGATGTACTGAAGCTCATGGTGTGTCCGATCTTTGCTGCC
ATGCCGCGTGAGTTGCAGATGAAGGTGTTTGAACCTGCACCTGATGGAGTACGCAAGGTTATCCTTGCCACGAATATTGCCGAGACTTCGATTACAATCA
ACGGTGTGCGCCATGTCGTGGACACGGGGCTTGTGAAACAGCGCTCGTTTGTGGCGTCGAGCGGGATGGAGATGCTGCAGACGGAGTCAGTGTCGAAAGC
ACAAGCTTGGCAACGCACAGGTCGTGCAGGTCGGGAGGCGCCTGGCATCTGCTACCGTTTGTTTCCAGAGGAGATATTCGAGCAGCTCCCAGAGCGATCC
ATCCCGGACATCCAGCGTGTGAGTTTAGAGGTCGTGGTGTTGCAGCTGAAATGCATGGGGATCGACGACGTCTTGGGTTTCGACTTTATCGAGAAACCAC
TCAAGTCATCGATGATTAAAGCGCATGAAAAGTTGTACGCGTTGGAAGCACTCGATAACAAGGGCAAGTTGACCACGCGCGGCCGACAGATGGCTGGTTT
GCCCGTGGAGCCCATGTATGCTGTAATGCTGTTGAAGGCGACCGAGTTGGGATGTGCGGAAGAAGCGTTGAGTGTCGTGGCCATGCTCTCTGTCGAGTCC
ATCTTCTACTCTCCTCGTGACAAGAAAGCCGAAGCAGCGCAGTCCCGTGCACGGTTCATTGCGCACGAAGGCGACCAGATCACGTTGCTCAATGTCTTTA
ATGGGTACACCCAGTGTGGACCAAAGCAGCGCACCAAGTGGTGTCGCGACCACTACATTAATCACCGAGCTATGACTCGTGTGGAGAGCGTTCGACTGCA
GCTGAAGACGTACCTGGAGAAGCTCGAGCTGCCGATTGACTCGAGTTTTCCGGACCTTGATCCGTTGCGCAAGAGTATCGTCGCGGGTTTTTTCCTGAAC
ACAGCCATGCGGTCTGTCGCCGAGGGTTTGGGTGGTTCCAAGACTGCGTACAAGACAATTCGTGGTCCGTCCGATATTGTCAAGGTGCATCCTTCGTCGT
CGTTATTCATGCGCAATCCACCGCCCAAGTGGGTCGTTTACAATGAACTAGTGTTTACAAGCAAGCACTATATTCGATCCGTGCTCGTGATTGAGAAAGA
GTGGCTCGTGGAATTAGCACCTACGTTTTTTGCCAAGAAAAATAGAGTGACATCGTAA