Transcript Name :
Hyaar_Emoy2800027
Orientation:
(-)
Number of Exons:
1
Description :
Histone-lysine N-methyltransferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
SET domain10.918PS50280
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-458
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
3933
Sequence
        1377 bases(100 bases per row)
ATGAGTTGGCAACCAAGCGTGTCGGTCCAGGCGGCCTTCAAGCTCTTTGACGACGACAGCAGCGACGACGAGACCGCAACGCCGCTTGTGGTATCTCGTA
GTATGGTTCATATTTCTATTGTGGATGAAACAGAGACTCTGACGGCTGAGAAACAGGAGCTGGACGCAGCAGCTCAAGTCACGCGCAGTTTGTATGAGCC
CTGGGACGACGTAAAGCCATTGGTAGTAGGACCCATCGATCTGTTTACGAACTTCGATGGTTTCGGTGGAGAACGCGGGTATGTGGCCTCAAGAGACCTC
GATCCGGGTACACAGGTGCTCGTTGAGCAGGTATACGTGCCCTGGCCGCGTGATGTGGACGCATCGGACCCTGAGTTCTTCATGGCCACGATGGAGTCAG
TGCTAGTGCGGCCAGATTATGCTGACATTATGCAGCATTTGAGCCATTTGTACCCTGAGAAGCTTAGTGAACTACCGGAAGAATTGCTTACTGTAGCAAG
GAAGAAGTACGGCTCGCAAGTGGACGAGTTGTGCAAGAACTTTGATTCCTTAGCGCTCTCGCGTGACCATGTGCTGCAGAATGTGCTTGCTATGCAGTGT
AACGCGTTCGATAGCGGCATCTTCCTCTACAGTGCCATGTTCAATCACGAGTGCAACCCGAATTGTGTCAAGTTTACGCCTGAAGACATCGGACTGGAAG
GTGCCGTGTCGGAGGTGCGAGTGGCACGGCCCATTGTCAAAGGAGAGCAGCTCACCATTTCTTACTTGTACCCTCGCGAACAGAGTCGTGAGAATAGATT
GAAGAATTTGTGGGAGCAGTTTGGCTTCGAATGCAAATGTGAGTTCTGCAAGCGAGGGGATAGCGTATTGCCCTCACCATCCACTGCTGCTGGTGACAGT
GATGGCACAAAGCCGCGCATGCAGGACATAGAAAAGGTGCTAGTTGCTGCAGAAGAGTTGATTCGAACGAAGCCGAAAAGTGCTGCTGCCGCGTTAGCGG
TAGCGCTAGAGGCACTCTCGGACGCGCTGGAGATTGCAGCTCATGATCACTTGGTATTCATGCGCATCCACAAGTTGGTAGCGGACTCATGCGAACTACT
TTTGGGTGCGAAGTCTGGGCGACTGTGTGAATACTCGATTCTTTTCCTGCGCAGCAGTTACGAACTGCTTGAGCTTCAGCGGACATACCTGAACCCCGAC
CACATCGACCTCGCACGTACGTTGAATGATGTAAGTCAAGGTATCCAGCTCTTGCTGTCGTACGATCCGACGGTGCTGCTCACGGAATTTCCGGAATGGA
AAGACTTTCGCCAAGCGTCGGTGGTTGAAAACCAATACCGTCAGGAGTATAAACGGCTAAAGCGATTGTACGAATAG