Transcript Name :
Hyaar_Emoy2800031
Orientation:
(-)
Number of Exons:
4
Description :
Tetratricopeptide TPR_1 repeat-containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-226
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1665
Sequence
        942 bases(100 bases per row)
ATGTCGGCGACTCTGCTAAAGCAGATGCTCGTGGATGCGGCGGCTTTACTCAAGGCTGAGCGCTACCAGGAGGCACAAGACGCTGCTCGTCGCGTGACGC
AGTTTGACCCGAACAACTTCCAGGCTTTCATGTGTGTAGGGCTCGCTAGCTTCCATCTCCAGCAGGTCGGTCTTTATGACTACCCTTTATTGGAACAGAC
CCACATGACCAATTTCTATTTCTATTGCAATTATTTGGAAACCATTATTGCTGGTACTATGGTTTTATTGCAGTGGGGGGACTGTGAAGAGGCGTATCGG
CGAGCTTCGGATTTAAAGCCGGAGATGCCAGCACCGTGGAAGGTGGGTGGATTACGTTCTGGGTCGCTCTTCTTATATGATAACTGATCTTTTTTATGTA
CTTGGGTTGCTTCGATAGCACCTTGTAGACCTTTTTGAAGCCAAGCACGACTTGAGAAACAAGTTGGAGCCAATGGAAAAACTTGTAGCGATCAATTTGA
GGTGTTTTGGATGGAGGGGTCATTGGAACTTGTGTTTTTTTGGTCTCTTTGCTAATATGATTCGGGCATTGGTGGCGTACGTAGGAGCAAGAAGTTTAAG
CGATGCCAGAAGTGGGTCGCAGAGGTCGCGACAACGGCATTGGAGCTTAAGATGCTTCCAAAAGTACGTTGTTGTGCTCCAACTCTTCGTTAAACCGTAT
GAAGCACTGGATATGGTCTCTTACTCTATTCTGAATACTTTTTGCTGCTCACGGTTGATATGCAGGCTTTCGACGCGTGGTACTCACTTGTGGGTAAGCA
GACTGGAGCTTCCGGCCAGCTGTCGATGGAGGAGACCCCAAATGAGGAGCTACCGTCCGTGTTGACTATATGGCTGGATCTAGTCGATCTACTGCAGGTG
AGGTATTGTAGTTATTGTGTGCTGTTAACTCGTCAGGCTTAG