Transcript Name :
Hyaar_Emoy2800034
Orientation:
(+)
Number of Exons:
5
Description :
tRNA pseudouridine synthase A, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-323
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3934
Sequence
        1349 bases(100 bases per row)
ATGGTCCTGACCGATACGGACGCGTCCGTCGTGACATCTCCCAGTTGGCGTTATTGTCTCCACATTGCATACTATGGAACCGATTTCGTTGGCTGGCAAC
GACAGCATCAAGAGGTGAAAAGCAGCTTGGGGCTCGACAGTGTTCAGGAAGTCGTGGAGGCTGCAGTAACGGAGACCTTAGGAGCTCCACAGCGCGTGAA
CGTCACTGGAGTCAGTCGGACGGATGCAGGGACTCATGCTCTATATGTATGGCCTTAGGGATATTGAAGGGGGTTGGTTATACTGGAGTTTCTAGACTAG
AAATGGTCTAAGGGGATATGTGAATTGAACACCGTACGCAGCAAATGGGGTTCATCCAACTTGCTTCAGAAGTACCCATGTCGTTGCAACAACTAAAAGA
CCGAGTGAATGCCAGGTGGCTGGTTGTCGGTGTTTTGAACTTGGGGGGGAGGCTGATGTATTTTTTCCCGTCTATTCAACCAGATTGGGAGATGGTCAAG
TAGTGGTGCTGGGTGTGACGATCCCGACGACGGGGCCCGCGCGGATCCGGTCACGCTACAAGAAGTACATTTACTATTTGCAGCAAGGACATCGACCAGA
TCTTGAGCTGGGCAAGTACTCGTGGTTTCTTGGTAGAAGGCTGGACATTCAGCGGATACGAGACGCGCTAGAGTGCGTAGGAGATAGAAAGCATTGGTGG
ATGCGTGTACGTGAGGTGAAAGCTAACTTCTTATGATACAGGTTTTTGGAGGGCACGCATGATTTCCGGCCATTCTCACAGGGACTTCAGAGACCGCAGT
TCAAGAATATGGCAACCTTGCGTACCATCATATCGGCCAAAGTCATCGTTCGACGGTATGTAGACACACGTTTTTCTTGTGTGACCCGCAGCAAACAGCT
CATGTATCACGGGTGTCATGAATGACAGGAACGTGAACTTTTCCCTTGATCCCGCAGTGTGCGGTAGTGGTGACATCATCGACGCGAAAGACATGTACCA
AGACAGTCATTCAAGCGGAGACACCACCGAGACACACACTTCGAATGAAAACAAGGCTGCTACAGTCAATGGGCTCGAGAAGCAGAAGACCGAGTATGCT
AAAGGAGTCGTGCCCGTGCACTTTGTCTGCATTGAGCTGGTTGCCAATGGTTTCCTACGACACATGGTACGACGCATCATTGGAACGTTGCGGCCAATTG
GTGAGGGTACCCAGCCAGCTTGCCGCATGCAGCAGGTATTGACAGGTGAAGTCCCGCCTGGTCCGTCGGCGCCAGCTAAAGCTCTCTGGCTGCATCGCAC
TTGGTTCACGCAGGAGCAGTATGACTCAGATCGCGTGGCTGAAGAGTAG