Transcript Name :
Hyaar_Emoy2800021
Orientation:
(-)
Number of Exons:
2
Description :
60S ribosomal protein L27
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-89
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
1534
Sequence
        356 bases(100 bases per row)
ATGAGCAAGGCCAAGGTGAAACAGCGCTCCAAGGTGAAACCGTTCGTCAAGTACGTCAACTACAACCACATCATGCCCACCCGCTACGTCGCCGACATTG
ACCTGAAGAAGGTCTTGGACGATGAGGTGCTTGGTAACCCGGAGACCCGCATTGAGTCCCGCAAGACGATCAAGAAGGTGTTTGAGGAGCGGTACGTTTG
TAGCGTTTAAGTGATCGAGCTTTGTGGACTTTAGATTTGTAGCGAAGTGTGCTGACATGTTGTGGAATTTGTGACAGTTACCTGAACCAAGGCTCGTGCA
AGTCAGAGAAGAAGGCTGCTGGTGTCAGCTTCTTCTTCAAGAAGCTCCGCTTTTAA