Transcript Name :
Hyaar_Emoy2800000
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-261
NN-scoreoddsWeighted Score
0.5921.3570.003
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
Cluster Id
2120
Sequence
        786 bases(100 bases per row)
ATGGACGAAATGGCGAAAATGCTCGAGAGCTACGCTGGAGGTCTACAGCAGTCGTTCGAGTCGGTCTTCCAGCGTGTGGACCAGAGTTTAGCCCAGAGCG
CAGAAGTGATGCGCATGATGAATGAAGTGATGGAATCGGTCATGCTGCAGAACCTGCTTCTACTCTCGAGCTATGATGTCAATGAAGGCCTGACCGTTGC
AGTGGAGAACCGATCGCAGGTTACACTGGGGCAGACCAAAGTGAGCGCTCGACTGCACGACGCCGACAGGAGCTTTTTCTCGGTAGAGATCGAATCTCTT
CCTGTCGGGCAGAAGGTGCAGTTTCACGCGCCGCTACATGACGCTGTTGTCGGTCCTGTCGCAGGCTTCCTTGAGCTCCAATGCACCAGTCCCGGCACGC
AACAGACACTTACGAAACGCTCTCCATTTCGGGTGTTGTACTTCCAACAAGGAAGGTTTGAAGCTGCGTTGAGTGGAGAAGAGATGGCTACACCTGGCTC
GGGTGAAGTAGCGGCGGTGTCAGATAAGCTGCTGTTGACACGAGTGCGACAGCTTTTGAACATCAGTCCGATTCAAGGCATCTTGACAGCTGAGAAGGGA
AGGTATTGTTATATTCCAGCTGCAGCGCTGAACAACGATTATGTGCTCTATCTCTCGGTCGAGGAGAGTGGAGCGGGTAACCCGGCATACCGGGTGACCG
TGTCTGCAGCTGGAAGTGCTGATACTACCGAGGGGCGCCGGCGACGATGCCAGGAGATAATTGATGAGATGGAGATCGTAGAGTGA