Transcript Name :
Hyaar_Emoy2800019
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ferredoxin reductase-type FAD-binding domain14.357PS51384
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
96-128
204-222
288-344
517-614
672-790
1-72
152-180
246-264
368-493
635-648
73-95
129-151
181-203
223-245
265-287
345-367
494-516
615-634
649-671
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
oxidoreductase activityGO:0016491IEA
*** None ***
*** None ***
Sequence
        2373 bases(100 bases per row)
ATGGACAGTAGCAACGTGCTCGACGTGCCCCCGGACTCGTCCGCTCACCACCAGCAGCAGCACCAGTTAATGAACTACAGCGTCAATGAAGACAGTAACC
GCAATGACGGCAAGTTCTTTACACTCAGTAGCACAAGCGGCACCAACATGACCGGTAAAGCATCTCAAATTGCCACGCCGTTTGTCTACGGGACGCCAGT
GGACAAGAACTACAAGACGTGGCCGTTCGTCACAGTCGCTGCGTGTGCAGCAATGGTGCTTTTTACCATGATCTACCACGAGTTACCAGAGTACCGGACG
GGGTTACGCTACCAGCTCTATGCTGCATTTGGCTCGCAAGAGGTCGAGGGGCAATGGGTTGGTGGACGGCGTGAAGTGGTCGAGTTCCTGGTCAATTACG
TCCTGATTGGACTGCCGTTCATGATTGGCGGCATGGCTCTTGCTCTAGGCAATGCCTTGCCACCTGTACCCACAGGAGCTCATCGTACAGCTATGCGCTT
TTTGAAGCGCAAGATGCTCGTTGGCAGCATCAACATGTCGTACGCTGAGTCCATGTGCACGCTCGTGTTTCTAGGTTTGAACGCCATTTGGTTTGCTGCG
GTCTTGTCAAGGAATTACGGGCTTCTTGCCAAGGCGAAAGTGACGGATGGTGCGTCCATCTTCCGACTCGTGGGAACAGTGCTTGGCTTCAATGCCGTGC
TCTGTTTCTCGCTGCTGCTTATCCCTGCAACGCGGAATTCCTTCTGGATGCTTTCGATGGGGATCGACTACCCGCATGCGATCAAGTACCACCGCTGGAT
CGGGTTCTTTACTGTTGTCGTCGTGATGCTGCATGCAATCCCGCACTATTACGTGTGGATCAAAAGCGGTACGTTCATCGAGTCGGCATTTCCTTGCATG
GACTGTGACTTTGCCACGGTCGGTAAGAGGCGTTTCGAGAACTTTTGCGGTCAATTAGCGCTGCTCAGCTGTGTCATCATTGGCGTGACGTCGCTCGGCT
CGATCCGCCGCAGGTACTACGCAGCGTTCTACTACTGCCACCACCTCTTCATCTTCGTGATTTTCTTCGGAGCACTGCACTTTTCACGACTTGTCATCTG
GATGTACCCGGCAGTATGTCTCTTTGTCATGCACCGCATCTTGGCTCGAAGCCAAAGCCGCATGCCGTGTGAGGTAGTGGATCTTGAAGCTATTCCTGGT
GAGATCACGCGGTTGGTGCTCCGCCGTTCCCCGGGCAAGTCGGGTCACTACCATGCTGGTCAGTTTGTTTATCTGCGTATTCCATTGCTGTCGCATACGC
AGTGGCATCCGTTTAGTATCAGCTCGTCCCCGATCGAGTACGAGGACACGTTTACCGTGCACGTAAAGTGCGTGGGCAATTGGACCAAGTCATTGTACGC
TGTCGCTATCCAGGCACGTGAAGAACGGAAGATGCCGCTTGTGTACGTCGATGGCTTTTACGGCAAGATGTCGGACGACTTTCAGCACTACCCCGCTCTC
GTGTTTGTAGCTGGTGGGATTGGCGCTACACCGATCATCAGCATTATGGGCAAGATCCTGGACTGCATGCGCAACAACGACCCAAACATGGAGTTCACGC
AGGTTTACTTCCACTGGACGTCTCGCGAACTTGGCATCTTTCACGAATTTGAGCCTTTGCTGGACGCTATTGAGCAGTACGATCCGAACCATGTCAAGGT
CAAGGTCTGTCTCTACTTTACTGGTGACCAGCATCTAGGTCGTGTGGACGTTCCCAATGGAATTGCTCTGAAGCCTATGGACGACACTAGCATGGTCCCC
ACGCGGCCATTCTTCCAGTCATCCCGGTCAGTGCCCCGTCAGATGTTGCTGTTTTTCGTGACGTTCACGTGCAGCTTTTGGTGTCTATTTCTCATTCGGT
ATGACTACCCGATTCTGGGTCCTCTGCGCGTCAACCAGCATCTGTGGCCGATCCAACGCGTGGTAGAAGTCCTCATTATGATTGTGGGGGCTAGCGTCGG
CTGGTTGGTGGTCTTCACGGAGCCAACCCCTCGATCGATGAGCCGATTGGAAAAGTCACGGCTGATGCCAACAATTGGCAGCTACGCGCCTGGCGAGACG
ATGACACATTTTAACCGCTCGTCCGAGTTCTCGCGCTCGCACTTGACGGACGGACAGGAACTCGTGTTCCGCCACCCTGTCCATCGCTTACGACTGGACG
TGAAGCAGCTCTTTAACGAGGTGGTTCAGGAACAAGCTTACAACTTTGTGATCAATATTACCGGCATTGGGACGTGGGTATCAGGTCCATCGGGTCTCAA
CCGATCCGTGGAGATCGAAGCCGCCAACTTCGCGGGCATCTTCGATGTGCATTATGAGCAGTTTGAGATGTAG