Transcript Name :
Hyaar_Emoy2800035
Orientation:
(-)
Number of Exons:
4
Description :
ubiquitinconjugating enzyme E2 putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ubiquitin-conjugating enzyme, E227.62PS50127
HmmSmart predictionP-Valprediction_id
RNA recognition motif domain7SM00212
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-123
NN-scoreoddsWeighted Score
0.7913.2590.007
*** None ***
TypeScore
mitochondrial565
GO
*** None ***
*** None ***
*** None ***
Sequence
        705 bases(100 bases per row)
ATGGCTCGTCGTCTCACCAAAGTACGTGTTTGTCTGGATCACCGTCGCTTTGCCTCGTTCCGAGCAATGAATGGACTGATTTATTGATTTTGTTGTGTGT
GTGTGCTATAGGAACTCACTGAGTTGATGCAGGATCCACCGGATTGGTGCAAGGTCAGCACTGTGGAAGACAATCTCATGCACTGGCAGGCCGTGCTTAC
TGGCCCTGTAAGTCGCAATGGAAGCAGATTTTTAGGGTCTATTCAATAGAAACTGCATTGTGATTGATGATGGCTCTCCATTGTGTTTGGCAGGAGAACT
CACCGTACGAGGGTGGCGTCTTCAACTTGGACATGCAGTTCCCTAGTGAATATCCGTTCAAAGCCCCTCGCGTGCGCTTTGTCACGCGAGTGTACCATCC
AAACATCAAGTCGCAGTCGGGTGAAATCTGTGCTGATATTATCAGCCAGGTGAGGATAAGGACCTTTGAAAAAAAGAGGAGGAGAACAGAGATGGAGAAA
TTGACATCTATTGACTGTGTGGCGTGTGCTGTAGAACTGGACCCCGACACTCAACGCGCTTCATTGTCTCACTGCAATCAAGCAGGTCTTAGAGCAGCCG
GATATGGACAATCCGCTCGAGCCGGAGATCGCCAAGCAAATGCACGAGAACAAAGTGGAGTTTGATAAGACGGCGATGGAGTGGACCAAGCAATACGCGT
GCTAG