Transcript Name :
Hyaar_Emoy2800024
Orientation:
(+)
Number of Exons:
8
Description :
4-nitrophenylphosphatase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-272
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3932
Sequence
        1384 bases(100 bases per row)
ATGACAGTTTTGTGGCGTGGAAATGCCCCCATTGAGGGTGCGGCGAACATGATCCAACTTTTGCGGCAGCTCCAGAAGTGCATTGTGTTTGTAGTAAGTT
CCAGAAAAAAGCTCAAATAGGATTAAAACGGGTTTTGGTGGTGGTGATTTAACGGCTCTATATTGACGACGGTTTTTACGGTGTGTAGACCAACAATGCC
ACGAATAGCCGAGCTACTTACGTGAAAAAACTCGGTATATGCTACTGTATTAATGAGGTCTTGAGATAAATACTGCTTCTTACGGGTGTGTATGTCTGCT
ACAGCGTCACAGGGTATTCCTGCTGTAGAGACCGATATTGTCACGTAAATTATGCAGCATATGACTGACTACTTCAGAGAGCTCTTTTTTTCTCAAATAA
TCTAACATGAAGGGCTTGTATACTCGCTCAGTTCTGCATGGGCTACGGTGCAATACCTGAAGCAGCACAACATTGAAGGCAAAGTGTACATGGTGGGTGA
GGCAGGTCTCCAGACGGAGCTGGAGATGGGAGGGTACCAAGTCAGTGGCATGGAGCACAGCGACATCAAGGGGTTTCCACACGTGCCAGATATTGACATG
GAGACAAAAGCTGTTGTCTGTGGACTAGACCGGTATGGAAGTAGCAGACAAAGGATCGTGTCTTTGCAGAGAGAATGGAGCTAATAATGGCGGTGCCATG
CGTTTGTCTGCACAGGTACCTTTCGTACTACAAGATGGCGCACGCTACGGCGTGTGTGCGTCAGATTCCGGGTTGCCACTTTATTGCTACCAACCCGTGC
GTTCGTGTCTTAATGTACTGCTTGTTGGACGTCTGTCTCAGTGCTGTGTGTTTCACGTTTGAGCAGAGACTCGACGTACCCGACGGATGGCGCCGTCGTC
CCGGGCGGTGGCTCTCTGGTCCACATGCTTGAGTGCGCCATTGGCCAGTACGTTCTCTCTTCATCTCGCAGCAGTGCTTAGATGCTAATCTTTGCATCGT
TTTTCGTGGAACACAGTCCTCCTGAAGCAGTGTGTGGCAAACCGTCGCAGGACTTGCTCCAGACCATCATTGCCACTTATAAGCTAGACCCTTCGCGCAC
GTGCATGGTAGGTACTTCGTGCTCCGCCGTATCGGATGTGATGAGTGATCTGACTTGCCTTGCGTTTTCCCGTCTCGTGCTCGTGGGATGTCATATAGGT
GGGTGATCGCCTTTCGACGGACATTGAGTTCGGTAACGCTGGTGGTCTACAAACGCTACTGGTGCTGACTGGCATCACGACCGAGTCCGAACTAGGCAGC
ATTTCGAATGCTGTTCACGTGCCTGACCACTACGTCGACTCCGTTGACGCGATCAACCAGTTTCATGCTGAAACAAGTATGTAG