Transcript Name :
Hyaar_Emoy2800006
Orientation:
(-)
Number of Exons:
1
Description :
aAA ATPase central domain protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Basic-leucine zipper domain10.151PS50217
HmmSmart predictionP-Valprediction_id
Basic-leucine zipper domain5.8SM00338
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-283
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transcription factor activity, sequence-specific DNA bindingGO:0003700IEA
regulation of transcription, DNA-templatedGO:0006355IEA
*** None ***
Cluster Id
4358
Sequence
        852 bases(100 bases per row)
ATGGCGGCAATGAACATGAACATGTACGAGTACATGCACCGCCCGATGCTGCAGCAGCAGCAACAGTCAGTGGACGCTCGAATGAGTGGGACCCCGTGCT
CGGACCGAGCGTCCGATCAGGAGGACCTCGATGAACGTCGTCGGATGAAGAACCGCGAGCGCGTGCGCAAGTGCCGGAAGCGCAAACAGGACCGTCTTAA
CTTTCTCGAAGACCGAACGGCCGAGCTGGAGAAGGAAAATGGTCTATTGAAAGCCAAAGTGGCACGAAAAGCGTCCGGAGTGAAGGATCACGAGCCGTTG
ACGGACGTGCAGCTCGATGAGCTGCGCAAGAGCCAGACTACGACGTTGTTGGCCTACATTCGTGCTTATAATGAAGCTGCTGAGGGGGCTACGTTTGACA
TGAACGCGTGTAGCATTTGGACGGACAATGCCGAGATTCTGTACGGCAGTAGTGGAACAAGCGTGACTGGTTTGGCAGGGATCATCGCCTGCAAAAAGTC
GAGCTCAAGTGTGTTTGCCAAGTACGACATCAAGCAGTATATGGTGCAGTGGAAGCCAAACTCGACAGACAAGTGCCTTGTCAATTGGGATATCGAAGTG
ATCGTGAAGCAGGATGCCGCAAAGGACGTTCCTTTGACCGCACCTTTTGCAGACGTGGCGCCTCATTTTGGTGCCACTGGTGAGGTGCTGACGTTCCAGA
TGACGTCGCACATAACTTTTGAGGGTGCCAAGATCGTGGAGGAAATTCGTCAGCTGAATTTGTCCCGCATCAGTGAGAAAGCTTTGGAGCAGTTTGGAGA
CGATCCTAAGAAGGCTGCAGACGTGCTGCGGAGTCTGATGAAGACTGCATAA