Transcript Name :
Hyaar_Emoy2800011
Orientation:
(-)
Number of Exons:
1
Description :
AlNc14C650G12331
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-94
NN-scoreoddsWeighted Score
0.8975.820.012
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        285 bases(100 bases per row)
ATGTGGGATTTTGCAGCGCATGTGTTCAACGTGGCCACGCCTACGTTCATCCCGACAATCCTGAAGTTTTTACGCGTCGCCGCCATCCAAATACTCGACG
AACAAGTCGAAAAGAGAGCATACGAAGAGAACATGCGCTTTCTGGTGACATCCGGGCGTATTGTTCGCCTTTTTCCGTGCGATATGTACGCCACGGACGT
AACTTTCCAGCAGAGCAACCGCTCTATTGGTAACAGTGGCGACAAAAACCGTTTTACAGCGGCAAGCACCAATTACATTGACTGA