Transcript Name :
Hyaar_Emoy2800022
Orientation:
(+)
Number of Exons:
1
Description :
predicted protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
27-188
1-3
4-26
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        567 bases(100 bases per row)
ATGCGGCAGCTCGGCGCCGCCTTTGGCGTTGGCGTAGCAGCTGCCATTGCAGCGCAATATATGTACCAAGTCGTGCTCAAGCACCGTCGCCACACCTTTC
ATTGCACGTCAATGTCGGTCCCAACGGTGCTCTCTGCAACAGACGCCGCTGCTCAGGAGCTGCTGGCGGAACAGATGTCCCGCGTCGCCTCCTTCTTTGG
CTCTGAAGGCTTTGACAATGTCAAAAATGCGTTCGTGGTGGTCGTGGGTCTAGGCGGAGTGGGCTCTCATGCTGCACATATGCTGGCACGCTCGGGTATT
GGCAAGCTGCGACTCGTCGACTTTGATAACGTGACGCTCTCGTCGCTGAATCGCCATGCAGTGGCTACACGAGCCGACGTGGGACTATCCAAAGTGACGG
TGATGAAGCGCCACCTGCTTCAGATCGTGCCGGACTGTGACGTCGAAGAGATGGCTGTCATGTTTGAGGCCGAGTCAGCCGAGGAGTTACTGGAAGGTGG
CAGAGTGAAGACGTTACAACGGGTTGCTAGTGTCAACGACGTGAAAAGACTGATTGGTGTATGCTGA