Transcript Name :
Hyaar_Emoy2800026
Orientation:
(+)
Number of Exons:
7
Description :
actin-related protein 2/3 complex subunit, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat8.804PS50082
WD40-repeat-containing domain8.571PS50294
WD40-repeat-containing domain8.993PS50294
WD40 repeat9.907PS50082
HmmSmart predictionP-Valprediction_id
WD40 repeat4.3SM00320
WD40 repeat1.9SM00320
WD40 repeat0.032SM00320
WD40 repeat370SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-352
NN-scoreoddsWeighted Score
0.5231.0910.002
*** None ***
TypeScore
cytoplasmic522
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
Cluster Id
3999
Sequence
        1752 bases(100 bases per row)
ATGGTCGCAGGGAGTGACGCGCAGCTCTTCCGGCTCGCGAGCGGCATCTCGTGCCACGCGTGGAACAAAGACCGCAGCAAACTGGCCATCTGTCCCAACT
CGAACGAGATCTGGATCTACTCGAACTGTCACGTGCTGGATCCGTCCCAGTGGCGCAAAGAAGCTGTACTTACGGAACATGATATGCTCGTGTGTGGTCT
GGACTGGTCGCCCGTGCACGACCAGCTCGTGTCGTGCTCGCATGACCGTGGCGCTTTTGTGTGGAAGTACGAAGCTGCGTATCGGCAGTGGAAACCGCTG
CTCGTGGTGCTGCGTGTGACTCGAGCAGCTACGAACGTCAAGTGGAGTCCAGACGGTAGGACAATTTAAATGATTAAATCGTTAAGAGGGATAGAAATAG
AGGAGGTTGGAGATGATGCTGATGATTGCAATGTGTGATTTGTGTGTGGTGATGTTTAGGCAAGAAGTTTGCCGTGAGCAGTGGTGCCAAGTGTGTCTCT
GTGTGTTACTACCAGGAAGCAGAAAACTGGTGGGTGAGCAAGATCATCAAGAGACACAAGTCTACGTACGTAAAAATATAAGATTGGCAATGGCAGTAGA
GCTCTTGAGAAGAGCTTGGAACAGAGTAGTTACCTGATGTGTCGTGGGTGCAGGGTGACGGACGTGGACTGGCATCCGAATAGCCAGCTACTGGTGACTG
CGAGCACGGATCTCAAGTGTCGCGTGTTCTCGGCGCACGTCAATGACGTCGACGGACCGCCTGATGCAGGTCCATTTGAAGCTTTGCCGCCTTTTGGTGA
GCCGCTGGCGGAGTTCGACAATGCTAGCGCATGGGTGAACGCTGTAGCGTGGTCTCCGAAAGGTGACTGTTTGGCATTTGCGAGCCAGGGGTCATCCATT
CACATTGTCCACTTTGGTGCACCTGGCGATTATCCGACGATTCAGGTACTGTTCGAGTATTTTGGGGGAGAGAGGGGTGCAGATTGTTGCTTTAATGGTC
ACGCGAGCTTTTTTGCTGTATGGTGCACGTAAACTTACATGACCAGTCGATCCGGTTCTCGCACCTGCCGCTGATGCGAATCATGTTCCTGTCAAACTCC
GCTATTGTTGGCGTAGGTTATGATTTCAACCCAATGCTGTTTTCTAAAGATGGCAGCAACTTTTGGTACGATTTCTTGTCGCTATAACGTGGAAGTGTTT
CGTGTGACCAAGTGATGACATTTTGTCGTGTAGGTCGTTTTCTGAGTTTATGGACAAGAAGCCGACTGAGACTGCTGTGAAGACAAATTTGGGCGGCTTC
AGTGCAGGCAAGCCCACTCTATCTGTGTTGTTACAACCCGGTTGGTTCTAATTTTACAGTGTGTACACATGGAGTCCAGCTCGGAGCCTGTTTGAAAGCA
AAGTGACGCGTGGACAGTCATCCGATGCTACTCAACACGATAAAAACATGCTGTGGATGTAAGTGGATGCGTTAACATTACGGTTGAGGACACGAGTGAA
TCGTGCGGGTGGCTAATGAACCTTATGACCGCAGGAAACACGAGAGCAACATCACGTGTATCCAGCCTTACGCGCGGTCCGCCTCTGGTGGCGTGACGGA
ATTCTCGACTTCTGGTACGTGCGTGCGTAATCATTTCTAGTGCCATGGTGATCTCATGGGTATTTTTTTCTTTTGGAATAGCGCTTGATGGTCGCGTAGT
CCTCTGGAAATTGGGGAGTCTACACGTGGAAATGAGCAAGCTGCACCTGTAA