Transcript Name :
Hyaar_Emoy2800023
Orientation:
(+)
Number of Exons:
1
Description :
ubiquitin-activating enzyme (E1), putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-145
NN-scoreoddsWeighted Score
0.7763.7740.008
*** None ***
TypeScore
cytoplasmic522
GO
*** None ***
*** None ***
*** None ***
Sequence
        438 bases(100 bases per row)
ATGCCTGCGCTTTTCGGGCAGTCAATGGCGGCCTATGTGCTTTGCGACCTGGCTGGGAAGAAGATCAACCCCGAAGCGACAGCACGGCTGTCACGTGATC
AGCGAAACAAGCTGTACCAGAAACTACAGCAGCGCGAGCACGTCCTGTTCCACGAGGGCCACAAGATGGAGCTGCAGAAGGACGACATTGAGTTTATCTA
CCAAGAAATATGGCGCGGATGCAGCTCCGTCGGCCAAGCGAGGAACGGAGGTCACGATCGACTGTACTTGTCTCGTTGGCGAGCAGATCGACCGCTGCAC
CCGGACAACGTGGTGTACCTGACGATGAAGGAACTTGCTGTCTTAGACAAGGACGGCGTTCAGGGCTTTGACCCTGAAGTTGTTGCCCGCGTTGATGCAC
GGCTTAGCCAATTTGGTAGTTGGTCTGTCCCGCAGTAG