Transcript Name :
Phyke_g1372
Orientation:
(-)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtype1.3SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype140SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype7.1SM00368
Leucine-rich repeat, ribonuclease inhibitor subtype0.67SM00368
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Leucine-rich repeat, ribonuclease inhibitor subtypeIPR003590
*** None ***
InsideOutsideTMhelix
1-1394
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        6590 bases(100 bases per row)
ATGACGATCCAAGCGAAGCGAGAGactgctgcacttgtgcaCCCGACACCATTATCTCCTTCATCCAAATCTTCCGATGCAGTATTGGACTTCAGCAATT
CGTATCTAGGGGACGACAAGTTCGCggagattgtggagaaggcGCGACTTACGAGTGTTTCCACAAGACTCGACTTGCGTGGCAACTGCTTCGAAGCTGG
CGCTGCTCGGGCactggcagcattgctgcgCTCTTCCCATAATATCGTGTCTATTAGTTTGGAGTGGAACAATGTTGGTTTGCTAGATCAAGGTGTGGAC
GCTCTGGCCGACGCGTTAGAAGTTGACACTCGGTTAGTCACGCTCGACTTGCGTAACAACAACATTGGTCCAGAAGGTGCCAAAGCACTTGCCAAGGCTT
TACGTCGCAACCGCACGCTGCGTCAGTTAGATTTACGATGGAATGAGGTCGGGAATCCAGGTGTATTAGCGTTCCGTGAGGCGCTGCAAACCAACCATTC
GCTGGTGTCGTTGGAGTTAATGGGCAACAattgcagcttgaagcacGTCGATGAGATCGAGATGTTGCTTTCAAGAAACCGCGCGTTTATAGGGAAGCAG
CCACCTCTGGCCGTCGATGCATCCTGCCAACCTGACGAAGGCGGTGAATCGAACAATGACGCTGTGAAGTCACCGGCAGATGACCAGCTATTGCTGCAAG
TGCTagcagagaaggaagagctcGAGACGGAGATAAACATAGGCAAACGAGATCGACAGAAATTGGTAGGCTGCGTCGTGGATAAATTCTGCAGTGATCT
GGTGGTAGCTCATATGTACACTTTAAATGACAGGTTGAAAAGACcgaagagctggaggcacAGTTCCAACAGGCCCGCAAGGACGCCGAGATGGCCAAGG
AAGAACGAGGTCGATACCAGCAACGCGAGATTGATGCAAAGCGTGATCTTCACGAACTGCGCATGCAACTCGATGAGCTTGAGAATCGCAAAAAGCTGGA
ATTTGAGGAATATCGATCGTCACGCACAGCTCTTGAGCGTGAAAATAACGTGATGCGAGAAAAGATGGCTCACTTAGAGAGTTTGCACAGTAAAGAAGTG
GATCAGAAGGAAAAGCAGATCTCACAGCTGGAAGATGCTAAGTATACGCTTGACAACGAAATACATCGCACCACTCTCACCGCAAGGTAGGCGAACAACC
ACATTTTGCGAGCCTTGTAAGTGTCGGCTGCCTCACCGACGTTGTCTTGATCTGCCTCGAGTGTTGTTCAGgactcaagaagaagagattggAAAACTGA
AAAAGCTGTTGCAAGATTTACAACAGGAGTATGCCCGCAAGGAAGCCAAGCTGGTTTCCGACCACGAAAGCAGCTTAAGTGCCGCGCAACGACAACACGA
TATGGTCATTGGGTCTGTTCAAACCCAACTCAGCTACACCTCCACACAACTAGAATCGAGCGAGCGAAGTGTGCGTGAACTGAAGGAAAAGTGCGAAGCC
TTACAAGCGAAGGTTCTACAGTCTCAAATTGACCACGAGAAGATGATCGGagagctgaagcagcagtgggaTGCTGAAGTGCAAGAGCGCATACAGCGTT
CGGTTGGATCGGTTGAGGCGCAGGTGGCAGAAGTAAAGAAGTCACGACAACATCTCGAGCGTGAGGTCGAAAAACACTTGCAGACTATCATCCAGCTACG
TCAGGATAACATTTCGCTCCAGCAAGCGAGCGACGGTAAACAAAATGAGCTCCAGCTCGAATTGGAGGCGCAGTCCAAGGCtttgcaggagaagcagacT
CAgttggcaacagcaacgagcgAGAAATCGCGTTGTGGAgagaagctccagctccagctacGACGaatggaggagcaggatgCTCGATTCGTGCAGATGC
AAACAACCTTTGACGAACGCCTGCAGGACTTGACTTCTTCCGCGAAGACTGCAGCTGAGGAGAGCGCCGCGAGCTTGAAGGAGAAGGCAACTgtgatctc
gtccatggagaATCAAGTGTTGCAGCTAGAGCGAGAACTGTCGGCGCAAAAGCACGAACATGAGAAGCGCATCGATGATCTAGCAGAATCCTTTGGCAGT
TTCGTACAGGAGCAAATCCGCAAGGAGAGAGAACACCGCAAGAACCAGTCGCCACGTATGGATGTAAGGTCCAACACGTAGCCGGCATATTGCAATGTAG
GAAGGAATACAAGTTGCATTGCAACGAAGGTCTGGTTGAAGAGCTCGCAAAGTCTGCTGCACCGGGTTCGGTGCAACTGCGCTATGCCTATTAAGTCGGG
TCGGAGGAAACCGTGAGGAATGGATACATCCTTACTGTAGGCAACATGTCTTGACTGACGTACTTTGTCTCCTGAAGATCGCTTCAAGGATTGTTTCAAG
ATCGCGATATATGTGACAATCCAGCCATTTTGCCGTGCCGCTTGGCGCTTGAGCCTGTCCTGGAGCACGTTGCAGTGCACTTCAAATAGGAATCAGGCGT
ATCGCATAGAGATCGAGTGGCCGCCGCTCGACGAACACATCGAATTTCTACACACGGCATATGATGTTCATCACTGCCAGTGTCAAGTGGTTCACTGACC
CCTTGAGTTTCAAGTTGAGATGTGTCCAGAACATTTATCCAAGCCGACGGCTCTTTGACCCACAGCGTGGCCATGCCATCTTCACAAGATCTTCCTTTCC
CGCAATTCCCCCATGATCAGCTCATTGCAGCCTCCATTTTATACCATCTACGCTGCTGGGAACCGTCGGCGAGCCTGCCATCCTTGTCCTCTGTATCTAG
CAGACCCCCGATCTGGTTTTCGCGCCATCCAGTTTAAATGTCGCGATCTTTTATTGGTTCAAATCATTATTCCTGCCCTTTCATTCGTGGAAAATCGAAA
CGGTGCAGCCGTTTCGTGCCCATCAGTTCAGAAGTTGCCATGCGACTGCCGAGCTGCCGTTTTGCGACCTGCGCAAGGTGCCGGCGGGGGCCAGAGGACC
TGCCTGCAAGAGCCAGCAAACAACATTCTAGAAACTGTAACGTGCTGCCTACCTGCCTCAGTGTCGAGCTCGCTCGCCATCGTTCCGCCCAGTGTCAGTT
CTGCTTTGCACTCGGAGAGCTCACACCAAAACCAATTAACTGTTTAGCCTTTTGACTATTACTATACTGCATCGAAAATGatcgacgactgctgcttcag
cgaGTCTGCCAACGTACAGTCACTAATCAACAAGTTCGAGCTCATGGCGCAGGCCAATGCAGCGTCCAATGCCTCACGCACGAGGGCGGAGTCAAGCACC
ACGGCGCCTCAGAAACCGGTAGATAACCAGATTAGTCGAGCTCGTACCCAATCGGAACCTGTTCAGAAATTGGAGAAGACCCCTGAGTCTGTTGTGAAGC
ACAATACACTCACAGTCAAGACTCTGgagagtgacgacgaggacaacATCAAAACTTTGAACCCTTACGAAGATGAGAGCTATGTGGGGTCGACGATGTG
CTACGTGAATTGCTACTCGGCTATGCCTCGCAGTCCGTCGTCGTTTTCCACAGCCTCTACCGGATCTTTGGACTCTTTGTTGAGTTCCCTAGATATGTTC
CTGCCTGAACTACTGCAAGCGTCAAGCGAAAACATCAAGAGAACTAAGCCCCTTGTGGCACCCAAGTTAACCCATCCTGCGTTATATCGACGATCCTCCC
TCTCAAGTAGATCACCATCCACAACTTCCAAGGGGGTAGTTCCAGCGGCCACCAACCTACGTCGCTCGTCGCTGTACACCAAGGCCGCCGCTCCAGCGCC
GTCAGTGATCCCCAGACCTCGCCGTTCCTCACTTTCAACAACGAGCACGCCACCGACTAGCAAGTCCGCGCGACGTTTCTCCGTATCGACGCACGGTTCG
CCGCCAATGATGACCGCATCCCCACGCACGCATTGGTCGGATTCGGCGCCAGTTTCCAGGTATATGGACTATGATCAGTCGTCGCGCTTTGCGGTTACGA
AGGCCAGGAACCTTGAGCGTCGGCGTCAGCTGGAGGAGCGCAATCGCAACATGGCAGCtgacaaggccaagcagCTCAACAGCAGGACAACACGGAGACC
GCAAACTCCAGAACGACAAGGCCGTCTGGACCAGGTGCGGTCGCGTCTGTTCGACTTCCAGAGCGACCCAAGGTGGTCATCAGCCGCGAAGGAGCAGCCG
GGTTCAACCAGGCCAAAGCCCACCACAGTTCGAAGCCGCCCCAGCTCTGCCGCTAGTCGCGCTCGTGTCTGATCCTACTACACCCTCTATATTCTGTAGA
TCTGTGTGCCGAACATCGCGAGCACTGCCATAAATTAGCATATAAAATTGTCATATTTGTACATCAACCAACACCGAGCAAGTCATCGCTGAACAAACAG
GAAAAGCAGTTGATACTTGTTGAACCAGGTCTCCTGCATATCGATTGGTCTATAATGTATATAACGACTTATGATTGGTCAAATAAGCGTGGGGCCTCTA
TTAATGCCGTAAAAAAACGTCCAAACCATTCGTGCATTggccccaccaccaccatgacGACGAGTACGACGACGACCCTAGCAGAGCCCCTCATGTCGAC
CAACTACTCTCTACGAGCAAGTTACTATTGTCTGAATGCAACCGGCGAAGTTCCCGAAACCACCGCTACAAATCCTACCCACCCTAAGGCCCAGAAACCC
AGCAAAACCACCGAAAAGGCTTCGGAAGTACAAGTTACTGGTAATGCAGTGCAAGTGCCGCGTCTGAAGCTCAGTGAACTTAACTGGAAGAATCGCTCCC
GGTtcttggagatgatggagtGTCACTCGTTCGTAGTACTAACAGACCTTGGGGAGTCTCTGGAACGTGTTCACGACCAAGTGCTACAGGACTTTGACAC
ATTTTTCAcgagtgacgatgacgactGGAAGAACGAATGCATCAGCAAGCAGATCTACCGCAATGAGAACAAGACCCCAATGTGGTACTGTGGATACGAA
CACACAAGTGTTCGCGACTGCTTCCGGGTTGCTTGTGGCGATATGTCACGTCTGGTTTGGCCGTCACCAGAGTTCAAGGATCACTGGTTGTCACTGCAGC
GCCGCATGGAGAAAATCTGCGATCGTGCGCTGAGTCTAACTGTGGGGTATGAGATTGCGCCGAGTCACGCGCGCTCGGATGAGAATTTCTCAGTTTGCTA
TGGATTGCACTACCCAAATATTCAGGGCAGCGGACAGTCTGAGACTGAGAATGTGTTCGAGCACGTGGACCCAAGTCTCTATGTTGTGGAACCTGTTCCC
AGCGTGGAGGGACTGGATGTGTACGACCCTCACTCCAAGCAATGGCTGAAGGCTGAGAAGGTGTGTGTCCCTGGCAAGGAGATTGTGTTGTTCTGCGGCA
AGGCGCTGGCGCGCGCCACGGAAGGACGTATTCCTGGCACGCTGCACCGTGTTCGTCGAACCCCAGACCGGCGGTTCTGCATCATCTACGAGCAAAAATA
TGAGGAGTACTTCCTTTAAGTGCGGACTAGACTGACTTAATCGGGTACAGTAGGCAACGACGCCTGAGCTAAAGCACATTCGTATTCTAGAGTACAACAG
ATTACCGTCTATGTACATGGACATCGAGTCAAGGCTTGATGAAAGCCAGAGAACCATACAGTGTTGTAACGTGAGTGAACCTTAGCCGATCTAATCAAGC
CGGTCAAATGAGGCCGATCGTAAGATTTCAGGTAAAAGAAAATCTACTGCTCACAGCTCACAATGAGAATACATGTAAGCTTAACGTGGATCCGACGTTA
TCGTTGAAGATGCATCCTGCCTACGTTCAAGGCAATCGAGGCATTCCGGCTGGACTGGATCAACAAAGATCCGACATCGACAAGCTGGAACTGGTCTGCT
GACGCCAAACAACGGGCTATGCTTAAATTGGCATCGGATCGCGGTGCGAATGTGCTAGAGGAATATTCGAATTCTCCTCCGTGGTGGATGACCAATAAtc
ttgctactgctgctgggaACGATGGTGAGGCAGACAACTTGTAGGCTTCGTACAAAAAGCACTTCGCTCTGTACTTGGCCACGGTCGTGaacgaggccaa
ggagaacTGGGGTATCAACTTCGCTTACGCGTCGCTGTTCAATGAGGCTAATAGCAAGGCTTGGAAATTTCCAGAACCACAGGAGGCTTGCCATTTCTCG
ATTGCGACGCAAAGCGACATGTTGACGCTCTTacgcaagcagctcgacaTGCTCGGTCTGCAAGATGTGCTGATTTCAGGTGCTGAGCAAAAGAATCCGG
GGGAGTCGCTATTCACGCTCACAACGGTGATAGCAGACGTGCTCCCCGGTGTTGATAGCATCGGAAAGTTCAATGCGCATGGTTCTGATAGTCTGACCCC
GTACACCGGCATGGAGCGCGACAAGTTCGAAGTACTtacgagcaagaagaggcCGACCTGGGATTTCCAATatgctgatgaagatacCACAGGGCTAACT
ATGGCCGAGAACATCGTCAGGGACATCAACGAAATGAAACTCGCAGCTTTTGTGTGCCGGCAGTGGGGTGGTGGGGATCATGCAATCTAA