Transcript Name :
Phyke_g1374
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain4.7SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1887
*** None ***
*** None ***
TypeScore
nuclear478
GO
Biological ProcessGO IDPrediction Method
nucleotide bindingGO:0000166IEA
KO ID
K18533
K18533
*** None ***
Sequence
        6333 bases(100 bases per row)
ATGCGCCGACACTATCTCTTCGCCGAGGATGAAAAGGAGCGCAGTGTTGGCAACGGCAAGGCCAACCTGCTAAAATTGTGGCATACTCGACGATTGGCTA
TGATTGAGGGCGACGAGTCTGCGAACGGAGGCGAGGCAAACGCGTTGGTGGTTCGGGAACTGACGCTGATGTGGGACCTCGCCAAGCCTATGACGTCAAT
TCTGCTGTCGCGCGAAGGGTACATTGGTTTCTTCGCTCGTGCTGCAAAAGCTCTTGTGCTACCAATGACATCCGATACGgctgctattgctgttgcacaG
CGCGACTGGGAGTACGATCTAGAAGGTGTCAGTAGCATCAATGAGCCCACCACCAAAGGAATGTCAGTCCTGGACAACGAGATGATGGCACCTGAGCAAT
TCCGTGAAGCTCTGATGCAACTCGCTGAATTGGTTCTTCCGGTAGAAAGCACCGCTAAAATATTCGCATCTTTCTTTCGTGAGCTGCGTAATAGCGTCGC
GGAGGTTGACGCCATTTCCAGCAATGAGCCGGAGACCAACGTCGGAGATCCGGCCGATCGCCTTGTGCTCCGACCATTGAGTCGTATTCCTAAGATCAGC
AAAGACGCGTTCCTGCAGAAGTTGCCACCATCTAGCGATGCATTGCGAGCAATTCACGGATTGCAACCGCCCGATTCCCGCGAGATGTcactgaagcagc
tcttACTCAGCTATAATCCACGAAAATTCTCTCTCACACGAGCATTTCCGCACAAAGATCAGTCTAACGATAGTATCGATGAGAGTGTGAGCAACATCGA
GGAGATTAAAACCGAAGCTACAGATGACCCCGAGCCCATTGTCGAAGATGATATGGTGATGGCACAGCGACTGCATACTGAGCTGCTTGGTGCGATTGGT
GTAGGGGCGACCCCAATTCGAGGACGTAGACTTCATCGCGAAACCACTGCACAATGGGATGTGGAACAAGCACTCGTAGATACTCTGACGGAATGTCCGG
CGTTGAGAGTAGCAGTAGTGGGGCCACCTGGATGCGGTAAGACTCGACTTGCCCATATACTAGCACGACGGCTTGGGCTACGATATCTGTCACTTGATGG
GGCTGTTCAGCGTGCCGTCGAGCGTAAAACCCGCTTGCGTCGCCTTCGCGTCGTTGCTATCCCGTCTACCGACGGCGAAGACACAACAGATGAAACTCCG
CCATCGGTGGAGATTTCAGACAACGATGAAAAAAATCCAGGTGAAAACActgatgaggacgaagacatGGACCGGATATTTCAGGATGAACATCTTGACG
CACTGCTCTCGGGGTGCGTGGTTCCCCGTGATACAGCACTTGCAGTACTTCGGTTAGAAGCTACTCGTTCGCTGCTTGGTACGTTTGCAAACTATTTCCC
TCTAAAAGATAGCTAACTCATGTCTTGCATCCAACACCAACTATTATCGTGATAGCTGGCGTTGGAGTGATCATGGACAACGTGTATCCGTCTGATCTTT
CAGCTATTGACAACCCGGATCATAGAATAGGAACCGATTACTTGGTCGCTCTCACGGCACTGCCCAGCGAGTTGGAGTATCAGCTTGGAGGTTCAGAATT
GGCACCAGCGGTAGGTCGTTTGTACTCTGTTCGGGAGCTCGCCACTTTGAAAGCGGCAAGCCACGAAGAACTAGCCGCAAAAGGTTTCGCTGATTTTCTC
TTACCAGAGAAGAAACTTGAGGCTGAAGCTGAGGAAGTTCAGGGGCCTTCTATTGCAAATGGGAATAATGGAACTGAACCTGGCACCGAAGTTCAAGAAA
CCAGCGAACACGACTCAAACGATCAGGAGGAAAATGAAGGCCGGGATGACGCTCCACCGGAAGAAATTATTGTTCCAGCACCGGAGCCAACACCTGCCGA
GCGCAACGAAATCGAATCGCCTAGGGAACCTACTGTCTCGTTTGGTACAATAGTTTTGACAAAGTTTGCCCAGAGATACCACGAATACGTCACACGCATG
CAGCGTGAACTCGCGGTGTCCCGAACTATTGCCAGCACGGACAGCTATCATTTGGTAGTGGTTCAGGCCACCCAGTCGCTCAGTGCCATTCGAGACCACT
GCATCCAAGTGATCACAGGCGTAAGTAGAATCGTAAATTGCTTCACGGGCATTTTCACTTATTTAACGCTCGTGTATTTTTCAGACGTCACTGGGTCTGT
TGCGCTTTAGCGTATCACGTGAGGCCTGCCCCGTACTGCTGCCCGATGATCTTAGTAATACTAGTCGTGCTGAAAATATGAGGTGGTTGCTTTATGGAGA
CTGGACCACGCTTctcgaagctgaagaaaGTTCCACCACAAATATGTCGTTCACCCGGCTGCCTAAGCGCAATGCAAAACGCCGATTGCTATCCAAGTGG
CGCGAGTTTTGTCCCGTGGCATCATCTGCGAACAATGAACTAACACTCGGTAGTCCAGAGTTTGCTGTATGCTACTCTGGGCGGGTCTACCTGCTAGCCT
CACGAGAAGCGAGGAGCGTCTTCTGCGCACATCCCCTGCAGTTCTTGCGTCGAGACGTCCCAGTTCCGTCAAAGTTTCGCAATTATTGGCTTGTCACCAC
AGGTGGTGGCGATATTTTGTCTCCTGCGCACTTGGAGACACTGGAGGCAGGACTTCGCGTGCGAACTGTATCAGCCTCAAGGCTCCTCAAAACTTTACCA
ATATCCATGGAAATGCGTCTCATGAGAGGCCAGGTTGTTTCCCCTGTCGACGTTGCAACAGTAGCAGCCGAGGCATTAAAGGCACAACTGGCCAAGCTGG
ATGCGTCCTCTGGATGGATGCTCACGGATCTGCCGCTCACGCGCGACGTCGCTGCCGTGCTCCTCGAACATGGATGTGTACCTGACGCAATTTTGttgat
ggacgaggagcttACCGCTGCTAAAGAGGAGGCGGAAGTCATTAGCCCCTTGGCTGCATTACGGCGTCAGCAGTTCCAGACAGAGAAAGCTGGCATCGAG
GATGTTTCCCAAGCTCTCGGTGGCACAACTCGAATCATAAATTGTCCATTATTTCATCAACCGACCGAGACGCTGGCGGCCATTGAGCGCGAGCTTAATC
CTCTCGCACCGCGTCTGGACAATATTGAGGACGGACATGCGCCACAGATGGTCGACGAATATTACCCAGCGGCGATATTTGCCTCACCACATCCAGGCAA
CtatgaggaggacgaaggaAAGTTTGTGTCTTTATCACAACAGGATGAAGGCGACGCTCCTGATCCTGaggcagttgcagcagctgaagccGCAAGAAAG
ACATCGCTTCAGCTCCAGGGTGAGACTGGGCGATTCTGTCCGGTAGCGTGGCGTACGCGCGGCGCGATAATACCTGGACAGCCATCATACGTTTGTTCGT
TCCGACAAAAGTTTTATGCCTTCGCAGGAGAACAGGAGCAACGCGCTTTTGAGCGAAATCCAGCAGCTTACATCCCATCGGGACCACGTGCTACTGCTAG
TTTTGTACCATGTGTACTGCTACTTGGTGTGCGGGGATCCGGGCGGAGGAGAATTGCGGATGCACTTGCACCGACCCAAACGGAACTCGGTCATGCACCA
ATGGAGTACGTGAATTTAGACTTGACTGCCGTAGCAAGTGATGCTGACCGCCGCCAACAGCTAGAAGAACTCAAATCCGAAGATGCGCGCATGAAACCCG
AAGAATTATTTGTCAGTGCGCTTCAAGCCGAACTGAAGCGGCAGCAACCTGTTCCTGGGGAGGCTGTTGCACATGTCATTGCTGGGCTTGGCCAGGATCC
TTCACGTATCCCAAGTGCAGCGACACTGGAGATGTGCTTTAAGTATGAATTCTTCCCGGTACTTGTAGTTCCCCTGGTCATctcggaagatgaagcagtg
gCTACTCTGCTCAGCCGATGGACTGACAATTTACCGGTCCCCCGTCGAAAGCTTGCCCTCACTCGAAAAAAGGAgaaagatggagaagctggtgatgacg
gcgatgcactggaagaagacgacgaggaggaagaacctCCCGTAGATTTGGAAGCGGCGCGAGAAGATGAAAGTACGCGACTGCATGAACAATTCGTCGA
GGAtcagaagatgctggatgaagccatCGTTAGCCTCCGGTCTCGTGGCGTCAGGGTATGTAGTCCGGTCAATGCGTCAAGCGCACCAAGACAAACATCC
AAACGTATAAGTCGTATCTTGAACGAATTTATGACAGGACGAGAAACGCTTTTTGAGCGCTGCGACGTACTAGATATGACAGCGGGAAGCACAATGCACC
AATTACTTTCGTCAGGGGAGCTGCTAGTCGGTAAGCATGGATTTGTGTGCCCCGTGACAGGACGTACAGATTCTCTCTCAGCCACATCAACCATGGCGGT
GGTGTATCGTGATCAGCTCTACTTCCCGCACTCACAGGATGCTCGACGAACCTTCATGGCTTGTCCGGCACGTTTTTTGGAAAAAGCAAGCGTCCCACCA
AGGCACCAGTCAACCTGCTGCGTGACAGGGCCCCCATTATCAGGCAAAACGCGTGTAGCTCAGGAGATTGTGCATTCGCTCGGACTTGTCTACGTATCGC
CGCAAAGCTCAATAGACTGGGTAATACACTGTCAGGGTGGCTCCACGCTACGCCATTGTCTAATGGACATTGTCAACCGGCAGCAAAATCCACTAAGCGA
CGCTGACATGATACACAAGGCTATCTGTGCTCGACTGCGCTCCTCGGAGTGTCAAACGAGAGGCTGGGTACTGGACGGGTATTTTCTGGAGCATCGCGAG
CTACACCGTAGCCTTCAAGACCTCGAAGCAGACCGTCATCCAGCCACGGCTGAGGGCACATCGCAGAGCATTCAACCTGACATGTTATTCAATCTAGAGA
GTAATTTCACACATGTTTGGCAAGAACATCAAGTCCATGCCAACAAAAGTGAGCTCCACTCGGCATTCACACACTGGCATCAATATCGCTTGGAACTGCT
CAATACGTGGTCTCGGCTTTTTGGCTGCTTTCATGTGCGCCAACTGGACAGCTCAAATAATTCACTTTGGCATGTGGCAGCGCAAGCTCAAACATTTCtc
aaggagcagcaacagttaGCATCACTCCACGCTACTGCTCTCACATCAAGCCGTGCAGCCAAGTCGCTTGGCGTAGTGCGCACACGCGACCAGCTTCAAG
CACGTCAGCACCCGGTCTTCCAGATGTTCTGTCCAGTTGAGCTTCGCGCTGGGAAATTCTACGCATCTCATCTCTCAAGGCGTGAGCACTGCATTGACTT
CCGAGGTTTTAGTTTTTGGCTAGGAAGCCAACGAAATACCGAGCAATTCATCGAGAGCCCTGAGATCTTTGTTGGCCATCTTCCAGGAGAAGCCTCCACA
CCGCGAAGGCAAGAGTTATGGCCcactcaagaagaagctgagggCGAAGCGCAAACAATTGTAGCTAGAGCACCGGTGGACGCGTCGTTACTGAGCCTCC
TCACCGTGGCGGACTGCGACTTCCCTGAGCTAAAAGGCTACTGCCCAGTCACATTCGCGTCGGGCTCGGGCGCTAAAGATTGGGAAGCACTTCGTCATGG
TAGCGTCTTCTTCCGCGCATCGTATCGGTCCAAGATCTTCTTTTTCGTCTCTGAAGAAGCACGCCGTAAATTCTGTTACGAGCCATCTCGGTACGCGTCA
CAAAGTTTGCCAGTGAAGCTACCACCCCAAGTCACACTGTCTAAAAGCTATCCAGGCCAATTGGAACAGCAATTGGGGGCTGCCCTCAACGAAGTGTTGC
TTGCACTTGGAAGTGAACGTCCAAAGTTCCCACAGGTGTCGACTCGTGCATCTGCCTGTGTTTATCTTGCTCTCTCACTCAAGGCCCTCCAACGACGTTA
CCGGTTGAAAACGAAGCCTAATCCACACGCAGGTAAGACTCGAGACAATGACgagcaagatgaagagcagaagcaacGACAAGAGCGGCGTGAAGAGCAG
GCAGAGCGAGATGCCATTGCCCGTCGTGATGCCTTTGTGAGAGATTGTCAACTTGGAGAACAGATCAAGGTTGCATCCACGCCTGCAAATACTTCCTGCG
GGTCTGGAGCTAAAGTGGTTCGTACCATGCGTGCAGCTCATGACTCATCGGCTGAGAGTCACAATGATGCACAAGAGCGCGCCGGTGCAACACCGGCCGG
CGATGAAATTGAGCCGCTATGTCACCGCTTCGATTTCATCGTGTCAGGAAATGATAGTGGCGATAAGGCACTGCCGGTGGATATCCACGTTACGCGAACG
CACGCCAAAGCCGCATTCCTCGAGTACACCTAG