Transcript Name :
Phyke_g1345
Orientation:
(-)
Number of Exons:
10
Description :
hypothetical protein PHYSODRAFT_477034
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
832-867
1-808
891-929
809-831
868-890
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        5347 bases(100 bases per row)
ATGGCGCTGTCACCGGACGATGAGACTGCGTACAACATGCTGTccatgaagatgcagcgcgaCGTCAACTGCCTGGCAGACCCAGACCGTAGTGTGCGTC
GACGTGCAGCCGACAAGCTTCACCGCACGCTACAGAACGAGGCGTCACGAGTGTCTGCACCAGTCCTTCGAGCCTTGTGCACCACCAACCTACAGCGTCC
AATGCTGCTATGCGCTGAGAGCGACACTGTTGAGAAGTGCAGAGAGCGTGCGCTAACGTCATTGCTGCTTCTATGTGAGAACGGAGCGCTGGAGCCGTCG
GACGTGACGTTGCGGGAgctggtggcgttggccAACGCTCGACTTGGTAAACTGCCGTACCCGGAGCCTACGGAGGAGATCCGACTGCTGGTTCTACAGC
TTTTGTATGCATTCCTGAagcaatttgctgctgtgaaggagacgacgacgtcacTGCGTGATGTCATCACGGAATTGGCGAATGCACTGGGCAAAACGGC
AGTGGATCCTTTCCCCGACGTCAAGAAGATGTCTGCAGAGTGCGTCATTTTGATCTCGAAAACGTGGAAGAGTGATATGGCGATGCAAATTGGGACTATT
GTGAAACCCATTGTGATGAACCTCGGCCACCAGCACAGTCGCGTGCGAGTGTGTGCGTTGCAggcacttgaagctgcggtGCCCTGCGGTTTGGAGGCAC
TACCTGAGCTTATGAAAGAAGTGCTGCTACCATCCATAAACAAAGTCGTGTTTGACCACGCACCATCCGTGAGGAAGCAATTGGTGGTTACGTTGTCCTC
GTGGCTTGCACAGATCGAGCAGATTCAGCAATTTGAGGCGCCCCTGTTTCCACTTTTCCTGGCTGGTATTGTGGATGAAGCGCCTGAGGTGCGAATACTT
TCGCTTGCGAAGCTCAATCAGTTGTCTGTCATGTGGGAATCTTGTGATGAGGATAGAGGTGTTGCGTCAAGCGATGTGGAGATAATGGATGTGGACAGTG
GTGCTGTACTCGGCGCCCCACTGCTGTTTTTCGATACGCGACCTCCGCTTGGTGCTCGTAGGCTAGCACGTAGCATTCAATCTCAAGTGTTaccactgct
gctcgaaaAGACGGGCGATTGGACTGTGCAAGCGCGCGAGCGTTATACGCAAGTTCTCAGTGCATACTTGATATTGTTGGAGGAGAGCATGAACCCATTC
CTTGACAAGGTTTTTGCGGCGTTGAGCAAGATCTGCcgcgatgatgaagaggttGTTCTTAACGGCGTGAAGGCGTGCTTGAGTGTTGTCGGATTCTACG
CCGACTCACAAATGATTCTAGCATCGTTGCTGCCGATGGTGGCTGGTAGACTAGCAGGGCAGGACACAGCGCAACATCGCACAAATGGATTAATCCTGTT
AGGTATGAGCATCGAAGGCATGACGTCGAAGACGATCGGAGCTCATTTAGAGGTAAAAATTGCTATGGGGAGGAATGTTGGGTGTTTCACTACACATCGA
ATACCTAGCTCACTGTGCTTTTGCTGCGGTGAACGTTGTAGCTTATCGCAGAGGCGCTATGCGACGCTGGTCTACGCGAATCCGAAGTTGCTGATTTACA
GGATCAATTGGCTGGCGTCGTCTCAAGCATCATCAAGACTGCCGGCCCGCTGCTCCCCCAGAAGGACGAAATCAGCTTCAGGCTTTTCTGGGTGCTTAAT
CACCTGCTTGCAGCGTCTTCCGAGTCATCGCTTGCTTATGAAACGGTGACTCCCTAGCTATGCTATGCATGACAACGATTAGTGAGGTAGATGCCTTGCG
TTGAAGTGCTGACCTTTGTATCGCATTTTGCAACATGCATGGTATCAGGCGACCGAAGCAATCGAGGATTTTGCAGCGAAGATGGAGCAACCCTTAGAGG
TATGTGATTGATGCTGGTATTGTTCTTACCTTCTTGAGAGTAAATATCTGATGATAATATATCTAGGCACTTTACGTACGCTACATGGGGAAGCTTCTGG
ATAGGATGGCGCTTCCGGTCGACGCAGGAACGAGTTGGCAGAAAAGCAACCCGAATCGCGTGTTGTTCGATTCGCTTTGCCGGCGCGGGGGAGCGGTACG
AACAAACGTTTACATACTGAAAGCATAATGGCCGTTGTTTGACATCTCATCACTATACTTGCATCTTACTATCTGTTCAGGCGTGCGGTGAGAACCTTGT
GAAAATCGTGCCTGTCTTCTTGGTACACTTAGATCCGAACCAAGATGCGGATGTCCGGCTTGCATTCCTTGCATTGCTGGAGACGATGCTTGGTACGGAT
GCCATCAGCCAGGTGCGTCTAGGCACTTGCCTCAATATGCATGAAGCTTGCATGTCACTCTAATTGGCTTCACAAATTTGCATCCATCTTCAGACTTTTA
AACCATTCAGCGTCGATCTGCTTCAGAGAGCAATTATTCCAAACATCGTTTGGCGCGGAGGACGCGTAGCTGCAACAATCAGGTGGGTGCAACAGCTGAG
AGTTTGCGCTTCGCTTAATTGATTACTCATATTTTAGTTTGTGTCTGAATTCACCAGAAAAGTAGCTGTTGCATGCGCATACACTTTGCTCCGACAGGGC
ATTGCCGAACAAGCCTGCTTGTTTGAAACTGCGCCTCAGGTTTGTGCTACTTTGTTTAACTGCCCAACTCTTTAGCAGTCCATGCACTAATATTTCCTGC
TTTGCAATGATTGTAGATGTTGCCTGTATTAAAATCTTCTATGGATGACAGCGATGCCAAAACCCGTCAACTGGTTTGTCTTGCGCTGCAATACCTTTTC
GTGGCGTTACCTGGATGCTTGGGAGGTACGCTACAAATATGCACCCAAATTTTGTTGAAAAGGCTTTCATTTCACACGAAACATATTGCTCTGCTTGTTG
TTTTACTTTGGTAGACGAACCGGTGCATCAGCTCTACGCAGAAATCCTCAAGCGTctggacgacagcaacgacacAGTTCGCAAGGCAGCGTGCCAAACA
TTTACTACTTTCCTGCGTGCCGCACCGAAGGAGCATTTCCAAGGGACGATCATCGACTACACTCTAGACTGCTTGTTTGTTCATCTGGATGATTCGGAGC
CCGACATTCAGGTAGGAAAGCGTGAAAACTTCCAGCCATCTTCATTACTATCTCGTATACGCATCTGCTAACTCTTTGATTGATCACGTTCGGTTGGGCG
AATGCTACGTAGGAGGCTGTCTTCGAGGTTCTCAAGCAAACGGTGTCCATCGATGCACCACGGTTGGCAAAGAAGGCAGAAGAAAATCGGACTCGACACC
AAAGTCCTCGCTATTGCGACCAGCTGCTGACGTTAGCGACTGCACAGTCGGCATAAGCGAGGTTATCACACAGGCTCATTTTGCTATAATAACAACGAGC
AAAGTAGCCGTCACGATGCGACCTGCTGTGGAACACAccgccatcgtcatcgagAGAGACGTCAAGCTGTTTCCAGTTTCTGCTCGTCCAAGTTCTTGAA
GTACGCGACCAGATCTTTGATCCgtttcttgttcttctcgtcctccttttGTTGTTTCTCATGCTTGCGCTGTTTTCTCTTGCGGAATGTTGATTTTGCT
GCCTTGAACGTAAATGTTGGTGGTGTTTCTTGGCTTATGGCGTCATGGGGAGTCGATGACGCGCCGAGTTTCTGTCGTTTTGTAGGTCTCGTGTTGTCGA
CGCACTTGGCACCAGTAGGTTTGATCTTCCGTCCTGCTCTCGATGTCTTTGAGGATGCATTTATCGAGTTTTCCTGCAATTCGAAGACGTTCAGTTTTAT
CAGGACGAGATCTCATGATGTTTGCACAGCGTTATCTTTTATATTGGAGAAGTCGCTCTTGGTACCTTGTCGCTGTTAAACGTCCCAGCTGGATGGAGCA
AAGCACACTGGTCGGAGAGGACAATAGACAACGAGTTTTCAACTTAGCGCACTTACCGTCTTCGTCGGGAGTGTCAGATAGCTGGCAGGTCTGCTTAAGA
GGGGCTTTGGTCGTGATACGTCGGGTCTGCATGTTGGTGCCGCGAGTGCGCAATGCAActttcaagttgaagtgatcaTCACTCTTCGATGACTCTTTAA
GAGCATACACTCTTCAACTGTTTTTTTTCCAGATAGTACAATTATAGAGCATTTACAGGCACATCTTATTCTCGACAATTCAATTCGCGCTATTCAAGCA
ATTATTGCTTCGCTCATCGTTAACAACGTTCGATGCGGACTCGTAGGTTCAACGTGTTTGCACCCTCGGCATAAGACCTGAGGCATGATTGACGTATTAC
GATTGGACTATTTTTGATAGTTTTCAGCTATTTTTAGCAAATCGCGACCTGCCAAGGCATGCCAGCCGCTTCTTTTTCCCTCATACAACAAGGAGACGAA
CAACAGTCAAGAGGTGAACATGAGCGCTGTGAAGGTCGCCGCCGACGAGCCCCAGGGCACCATCACCATGGAGATGCCGCAGCATGCGCTGCAGAAGGTC
AAGAACCAGCTCGTGAAGGCCGTCGACATTCGGAACGTGCGCGGAATCTCCCAGTTCTTCGGCCTCGGTACGCCAAATGATCTTCCCGATCTCCCCCTCT
CTGCAATCCCTCGATACTAAAACGCTATTGCTGCAATTGTTTAACAACATTAACAGGCGAGGAGAAGCCCTTCAATGTGCCTGGACGAGAGGTTCTAGCC
TCGCGATGCCGCAAGAATGCGCTGTACTTTAGTGCTAACTATGCCATCTCCGCTGCACTCGTGGGCGTCGTCACAATGTACGCTTTAAAGTATTTTATTC
TACGTCTTATACTGGATAGTTGGAGACATTCTAACCGTTAATGTTTGTGTAGCCTGCTGAacccgttcttcttgttcgtgtTGATCTGCTTGGGAGGCTT
CTGGCTCTACATGTCAAGTGCGACTGCGAACGAGTCGCCCGAGAACCCGACGAAGATCATGGGGCGAACTGTTACTCCCGATCAGCGGAAGCTCGGCATG
CTTGGTGGTATGTGATTGCATTTGGTATCATGGTGGTGTGCTAGTAGGATGGGCTGACGTGTTGGTTTCACTCCGTGTTCCGTTACAGTTagcgctgctg
tcattgtCGTTTTCGGTGGTTCCATCCTCTTTACGATTTGCTCGGCTAGGTGAGGCTTCTGGACGTTTGCAAGACTGTATGGGGAGATATTTTGCTCACA
TTTTGCGGTTGTATCTTGCTTTTTATCCACCGCAGTGGTGCACTTGCCATTTCGCACGCAATTCTGCGTGACTGCCCCTCCATCCgcgaggaggacgagc
tTGGATTTTTGTCGGACGAGGCAGACCAGATCGCTGACACTGTTTAA