Transcript Name :
Phyci_286086
Orientation:
(-)
Number of Exons:
1
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Tetratricopeptide repeat-containing domain10.507PS50293
HmmSmart predictionP-Valprediction_id
Tetratricopeptide repeat58SM00028
Tetratricopeptide repeat3.8SM00028
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-306
NN-scoreoddsWeighted Score
0.8550.9990.002
*** None ***
TypeScore
nuclear783
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        939 bases(100 bases per row)
CGCATTTCGGATCCGGCGAGCATGGCGATCCCCAGCGGCGCGGCGGATTTCTTCGCGCTGCACACGCGCAAGCCCAAGACCATCGACGTGGAGATGCTGG
ACTACGGCTTCGTCGAGCGCTGCACCGACCTGGACGAGCTGAAGGGGATCCTGGCGACGCTCCGATCGGGCAAGGAAGGCCGCTACCCCGACCTGGAGAA
GGCCACGGAGGACCGCATCCTGGCGCTGCTGCCCGAGCGAGAGCGCAATAAGATCCTGCGCATGCGCTCAGGGCCGACCACGAACGAGCTGACCACGGAG
ATCGACGAGCTGGCGAACTGGGCTGCGGCGATGGACGTCAAGAACGAGGCGCTCAGGCGACAAGCGCCAGTCCAGCGAGAGCTGCCGCCTGTTCGAGGGC
AAAAAGCGTCTGAGGACACGCAGTCCAATTTGGTGCGAGCCCAGTCGAAACCAGCAAACTCCGAAAAGAAATCCAAAGCGATCCCGGCGTACGATTTCAG
GTCTTGGGAGAAGTACGACGTTGACAAGGCTCTGGAAGAGCTTGACGAAGAGAGCGAGCGAGCGCTCGAGCAGGCGAAACAGCAGCGAGAAGAGCAGGAA
AAACGAGCAGCGGCTCGGAAACGGGAGCTGGAGTCGCTTCCCAAGTCGGTGGAGCTTGATAGTCTCGAGCCGGAAGCACGGAAATTATACGCAGGGTATG
AAAAGCAAAAGGGGAACGACTGCTTTAAGGCAAACGAGCTGGAGATCGCGCTGTTGCACTACACTCGCAGTATGGCATACGACGACACTGACGCGATCCT
CTATGCCAATCGTGCATTGGTTCATCTTCGCATGAAGAACTTTGCGGCTGCTGAAGACGATTGCACGCGCTCCATTCTGCTCGACCCTAAATACATGAAG
GGGTGGAGTCGTCGTGGAATGACGCGATATCGGAGGGGC