Transcript Name :
Phyci_587874
Orientation:
(+)
Number of Exons:
4
Description :
metalloprotease family M14B, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-597
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2271 bases(100 bases per row)
CCATTGCTCCATTGCTCCACTGTTCCATTGCTGCGTGAGTGTCTCCATACCTCCCTCCTTGTTCGTCCTTTTTGTCGGCATGCACGGGTGAGCTCGTCAG
CTTTTGCCACCAAGTACTCGGAAGCCCGAGATCGTTGTCACCCCGATTCAGTCGTCCAGAAGAGATTCATACCCCGCCAGGCCTTCGTCTCTTCGAGCTC
AACTACTTCAGCTCAACGCAGCAGCGATGAGCAATTCCAACCCTCGCGCCAACCGGTTCCGCAAGGTTGCCAGCCAGTCACTGTTGCTGCCGCCCCCACT
GCCTCTCATCAACCTCCCGGAGGAATCGCGACTGGCCCGCACGGGGATCCAAAACCAGCGCCCAATGCACCTGCCAGTGCGCAGGCACATCCCCAACGCG
GTGGCTGTAGCTGCGTTGAAAGCCAACGCGGACGGGGGGCCAAAGTGCCCCGAAGACTTCGACAACCCGCAGCCGCCGAAGCGAGAACCCATTCTCATCG
AAAGCCGGGCGCTGCTCGAGTGCGAGGCTGAGGAATACGAGGAGCTCGAGGTGCTTGCCCGCCTTCACGTGTACGAGTACAACCAGCCCGACATTTTCCG
GAACAGCAGCGCTCCTGACGACACCCTCATCTTCGACTCGCTATTCGAAGGCGGTAACCTGCAGCGCGCGGAGCGAATATTTCGCAAGACGCCGAAGACC
GGGTCAGCAACTCACACTCCGCAGCAGGAGTACGAAATGCTCATCCATCCAGACATTAAGAACGGCGCCTATCGTCAGTGGTTTTACTTCGAGGTGCGCA
ACGGGAGACCCGGGATCATCTACCGCTTTGCACTCGTGAATCTCGCGAAAAGCGGCGCGCTCTTTGGCCAAGGCTTGCAGCCCGTGATTTACTCGGAGCA
TGATGCTGCAACCAAAGGAGTCGGCTGGAGGCATCGAGGATCCCACGTGCGGTATGACGTTGCTCCGACAGCTCAGCCGGGGCCCAACGCACTGACTTTT
CACTACCAGTTCGAGCATGAGAACGACTGTGTGTACTTCGCCTGCATTCAGCCGTACACGTACACCGGTACGGTTTCCGAGTTTGCTTGTGTTGTTGCCA
CGAAATTCATGTCCGCTTTGCCTTGTTTGTTTGCTCTTTTGTGCTGTGATCTGTAGATCTGATGGACTACCTGGAGCAGCTCGAGCGCGATCCACAGCGT
TCACTAACGTGTCGTCGAACAGAACTTTGCCAGAGTCTCGCTGGAAACCCGTGTGATCTGCTCTCCATCACGTCTCCGGGAAAAGACGGGATCCCGCCCG
ATGAACGGCGAAGTACGTGTTGCCCGCAAGACCCCTTTGCCGCATTCTAACTCGTTTTGCTGGCCAGTCATCGTGTTATCCGCGCGGGTGCATCCAGGTG
AGCCGAACAGCAGCTGGATGATGCAGGGGATGCTGGACTACCTCACAGGATCCAGCAGCGGTGCCACGATACTCCGGCGGCATTTCATCTTCAAAGTCAT
GCCGATGCTGAACCCCGACGGTGTCATCAATGGCAACACACGCGTTAGTCTTGCCGGTTGGGATCTCAACCGCAAGTGGAGCAACCCCATCGAGCAGCTC
TTCCCCACAGTATACCATCTCAAGCAGCAGCTAGCACACTTCCAAGCTTACGGACGTGTGGCCATTTACTGCGATCTTCATGGACACAGCATTAACCGTA
ACATCTTCATGTACGGCTGCTACACCACGAAGAAGAAGCCCAGCGGCTCAGATAGCGCTAAGTCTTCAGCCGCTGATGCAGCCGCTACGACGGGCATGAC
CACAAGTCCAGTTAGCAACACTGTGAAAACCGATCCGCGTGTTTTCCCCATGATTGTAGCTCGCCACGTACCGTGCTTTTCCTTTGCTAGTTGCGACTTC
AGCGTACACAAATCCAAGTTGACTACGGCACGGGTAGTAGTGAACCAGGAACTCGGCGTGACGAACAGCTACACCCTCGAAGCAAGCTTCTGCGGACCAG
ACTTCGGGGTGCACAAGGACACACAGTTCTCCACTTGGGATCTCGAGGAAATGGGTCGATCCTGGTGCCAGAGTCTGCTTGTATACTACGGACTCACCGC
CCAGGTCAAAGCACTGGATGCAGAACGTGAGAGACAAGCTGCAATTGGTGAGCGAATCGTTGTGCCATCTCCAACTGGTCGTCAAATGTCACGAGCACGT
GCTGGGGATGGATTGCTGCGGATGGAGACCGAAGATGAAGAGAGCCGCCTAGCGAGGGACCTGTTACTTGA