Transcript Name :
Phyci_10966
Orientation:
(-)
Number of Exons:
3
Description :
Hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
IQ motif, EF-hand binding site6.906PS50096
HmmSmart predictionP-Valprediction_id
AAA+ ATPase domain1.7SM00382
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-947
*** None ***
*** None ***
TypeScore
cytoplasmic348
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
nucleotide bindingGO:0000166IEA
*** None ***
*** None ***
Sequence
        2985 bases(100 bases per row)
ATGGCGAGCAGGTTGGTTGGTTGATTGTCTGTCACCGCTTCAAGTTGTTCGTGGAGCTTACGTGGGTGTTGGCGCAGCACGTACGACCAGCTATGGCAGG
AGGCCATGTCGGAGCTCAACGAGCAGGTCCACATCGAGGACCACACACTCGGAGACGGCCAGGACGGAGCCCCCAACGAGGCGGTGCGTCCCGTTCAGGC
GCTGCAGTTGCTGTGCTTGAACAGATCTAACTCACCTCTTGTCGCTTGTGCTGTGCAGCCGCCGCAAGCGACCATCGTGGAGGCATTCCAGCACTACGCG
TGCCTGTACATCAAGTACATCCAGATCCTGTCGCGCCTGTCCGAGTGCTACGACCAAATGGTGCACCCGCAGAAGCGCATCGACGTCAAGCAGGTGATCG
AGGTCGTGGCCACGCGCGTGGTCGAGCTCAAGCACTTGCTGGTCAAGTGGAACCCTCCCAACCCGGACGTCATGATGCAGCCCGAGCGCAGCTTCCCGTG
GGAGTACGTCAACCTGGACGACATCCTCGTCGACCTCAAGCTGCCTCCGGAGACGCTCGAGGTGCCGGTGCCGCAGTCGTTCCTCGACGACCAGCAGGAG
GATCTGTTGCGCCGCGAGCGACTCGTCAAGGGCTACATGAAGCTCAAGCACGGCGTGGACTCGATCCCTCTCGACGCCATCAAAGTCGCGCAAGCCGCGC
TCGCTAGCGGTGTCGGCGTGTTGTCGCTGGACGAGGCTATTGCAGTTATTCAGCGCAACGAGCGCGGTCGGCAGGGCCGCCAACGAGGTCTTTTAGTCCA
GGAGCTGCGCGAGGAAGAGCGTCAACGCAAGCTGTACGAGGCAGCTCAAGGCGCGCCTGAAATGGACCCGGACATCGCCGCCGCCAACATCCAGCGCATG
TTCCGCGGCTTCTTCTCGCGCGCTGCTGCAGCACGCGAGCGTGACGCGGAGTTGGTTTTCATCGGCATGAAGGCGCCAGCTATGGATCGCTCTGCGCTGG
AGAAACGGCTCGCCGATGCGCGTCTCCAGCGCCGCGTCGAGCAGGCCGAAAACAAGGAGGAGTACGAGCGCGCGCTGATTGAACTGCATGGGGTGGTCAC
CAATGAAGAGGGTCCGTTCATGAAGGAGAAGATGCTGGAGGAGAGACGTCGCTGGATCACGGATGTCATGGCCACGGGCCAGCTTCCTGAAGACCTCGCG
GGCTTCTACGCCGCCTTAAATGGGGAAGGAACCCCAGAGGAACTGGCCAaggcgcaggcgaaagaggaagaggaggcgaaagccaaagctgctgctgaca
agaagggggcaaagggagcgaagggcaagaaggaggagaagaagggaggcaaaggagccaagggcaaaggcaaagacgccaaggagcaggaggaggaagC
GCCCGAGAAGCCGCCTCCACTAACGGGGCCCTCCGAGCTCTGTACGAAGCTGGCGGGTGGTGTGGCCCAGTACGAGAAGGTGTGGCTCGAGCGCGAGGAG
CTGGACAATTTCTATCAGAAGTACGACGTCGCTCTAGCCAAGGACGTGGTGCGTGGGCCCGTGGAAGTGCAGGTTCGGCAGCAGGTGGACGAGATGTTGG
TGTTGCAGCTCGTGAACATCAAGGCGCAGCTCGAGGCGGCCGCTTCAGCAGGCaagaagggcaagaaggggaagaagggcaaagggaagaagggcggcaa
gaagggcaagaaaggcaagaaggatgccaagaagaagaagGGCAAGCCGCTTCCGGGCGAGAAGATATCGGAGCTCAAGGGCCGAGCACCGGACTCCTTC
CTGAGTGTGCTGGTGGAGCACCAGATCGTGCACGCGCCACGTCCTGGCGTCCGCGTCCGAGACTTCGTGGGCAGCTTCAACTTCCTGGGCACAGTCTACC
AGCACAGCGAGCGGCGCGATCGCTTTGGCAACTGGGTGCCGCAAGACCCATCGGCTGCTCAACTGCGCCAGTCGCTGACGGAGTACGGTGTTCTACCGCT
CGGATCGCCGTTCGTTCGAGCCCGCACGCCTATAGTACGCTCATTGATGCTGTACGGGCCTCGTGGATCCGGTAAAACCATGCTGGTGAGTGCGCTGGCC
AACGAGACAGGGGCGCTCGTACTCAATCTGTCGCCAAGCAACCTCGTTGGTAAGTTCGCTGGCAAGACGGGACCTACGAAGCTCGTGCACATGGCGTTCG
TGCTGGCCAAGGCGGCTACGCTGCAGCCCATTATCATCTACATCGACGACTGCGAGCAGGTCTTCGCGGGTGGCGGTGGCAAGAAGAGCAAGTCTGCTGC
TAACTCAGAAGGCCCCGTCCGGTTCAAGAAGGACCTCCTGCTGTACATCAAGGCTGCACTGGATCCCTCAGACCGTGTGCTTGTCGTGGGCACCTCGGCA
GATCCCGGCGCGGCGGAGGTGAAGGATCTGCGCAACTTCTTCGACAAGTTCCTGCATGTGCCGTACCCGGACTACGCGTCGCGCGTGCTGCTCTGGAAGC
ACGCACTGCGGACGACCATTGCTGCTCACGCTGCTACGTTGGGACTTTCATCAGCAGCTACAGCAGCGGCTCTAGCTGCTGCATCTTCGTCAGCATCCAC
TTCGGGCACAGGCGGTTCGGCCTCTCAGCTCCAAGATCGTCCCCGTCGCGAACCGATCGACATCTCAACGTTGGCTCATATCTCGGAAGGCTATTCCTCC
GGCAGCATCGTACGAGCTGTGGAGAGCACGTTGACGCCTCGACGCGTGGAGTGTCTGGAGAAGCGTCCTCTGCGCGAGGAAGAGTTCCTTGGTGCTCTAT
CGCGACAGACTGCTACGTTTGCTGAGGACCACGACAAGTTCAAGAACTTCACGGCGGTCATCACGGGACTGAAGGACACGCGCGACAAGATTCGCAAGGC
TGCGGCGGATGCACTCAACTCGGACGACAAGAAGGACGGCAAGGGCAAGGGAGGAGACAAGAAGGGCAAGAAGGGCAAGAAGTGA