Transcript Name :
Phyci_232811
Orientation:
(-)
Number of Exons:
1
Description :
unnamed protein product
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
529-532
1-510
511-528
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K01733
K01733
K01733
*** None ***
Sequence
        1599 bases(100 bases per row)
ATGGTGCACTACCGCAGCACGCGCGGCGGCGTCCGCGGCCTCAGCTTCGAGCAGGCGGTGCTCACGGGCCTGGCGGCCGACCGCGGCCTGCTGGTGCCCG
AGGCCGGCGAGTTCCCGACGCTGCCGGCCGACGCGCTGGACAAGTGGGCGTCGCTGTCGTACCAGGAGCTGGCCGCGGAGGTCATGGGCCTCTTCATCGA
CGAGAGCGAGATCTCCCGCGCCCAGCTGCGCGCGCTCGTGGCCAAGAGCTACAACTCGAGCACGTTCCGCGCCGAGGAGGTGGCGCCCGTAGTCAAGGTG
ACGGACCAGATGCTGGTGCTCGAGCTGTTCCACGGCCCGACCTTCGCCTTCAAGGACATCGCGCTGCAGTTCCTGGGCAACCTCTTCGAGTTCTTCCTGC
AGCGCAAGAACAAGGCGCTGCCCGCGGGCGCACTCAAGGACCAGATCACGGTGGTGGGCGCCACGTCAGGCGACACCGGCAGCTCGGCCATCTACGGCCT
GCGCGGCAAGGAGAACGTCGAGGTGTTCATTCTCTTTCCCGAGGGCCGCGTGAGCGCCATCCAGCAGCGCCAGATGACCACCGTGCTGGACGAGAACATC
CACAACGTGGCCGTCAAGGGCACGTTCGACGACTGCCAGGCCATCGTCAAGGACCTGTTCGCCAACGCCGACTTCAAGGCCAAGTACCACCTGGGTGCTG
TCAACTCCATCAACTTCGCGCGCATCCTGGCGCAGATCGTCTACTACGTCTGGGCCTACTTCCGCGCGCGCGAGCATGGCGTCACCGGCGAGATCGCCTT
CTCGGTCCCCACGGGCAACTTCGGCGACATCCTCGCCGGCTTCTACGCCAAGAAGCTGGGCGTGCCCATCGGCAAGCTCATCGTGGCCACCAACGAGAAC
GACATCCTCCACCGCTTCTTCTCTACGGGCAAGTACCACCGCCGCGACATTGAACACACCATCTCGCCGTCCATGGACATCTGCGTGTCCAGCAATTTTG
AGCGCTACCTGTTCGCGCTGAGCGGCGAGAACCACGACATCCTGCGCGGCTGGATGCAGGGCTTCGAGCAGACGAACGAGCTGACGATCTCGGGCGAGCT
GCTCACCAAGGCGCAAGACGAGATGGCTTCGTACGCCGTGCTGCAGGACGAGGTGCGCTCCACCATCGCCGAGTACAAGAAGGTGCACCGTTACCTCTAC
GATCCGCACAGCGCTATCGGCGCGGCTGCTGCCATGCACTACGGCCAGGACGCGCTTACCGACAAGCCCAACTCGGCCGTGGTTGTCGTTGGCACGGCGC
ACTACGGTAAGTTCCTGCCTGTTGTGTCGAAGGCTCTTGGCGTGGCCGAGACTGAGATCCAGCAGCACCCGATCCTCAAGTCCCTCGAGTCGCTCCCCAC
CCGGCTAGCGGTTGCCAACAACTCGAGCGCCACCGTGGCCGAACACATCCGCAAGACCATTGCGAAGAAGAACCAGAAGGCCTGCGGCGACTGCTTCAGC
CTGTGGTCGTCGGCCCCCACTGAGTGCAAGCTGGCCACGTTTGCGCTCGCCGCTGCGACGGTCGCTGCCGCGTTCTTGGTGGCTCGCCGCTCGAAGTAA