Transcript Name :
Phyci_93562
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-108
164-183
239-271
322-434
511-522
583-609
132-140
207-215
295-298
458-487
546-559
109-131
141-163
184-206
216-238
272-294
299-321
435-457
488-510
523-545
560-582
NN-scoreoddsWeighted Score
0.631.1330.002
*** None ***
TypeScore
endoplasmic reticulum667
GO
*** None ***
*** None ***
*** None ***
Sequence
        1929 bases(100 bases per row)
GCTCATTCCGGAATTCGCCGCCTCGTGCCAAGATGTCCAAGGTGCAGTCGCCTATACTCACGCCGCAGCTGACGCCGTCCGTCTCGGGCTACATCAACAC
CAAGCTCTGGGATGAGCGGCCCGTGCGGTACGCCGCCAACGTGCTCAAGCACGTGTGCATCTTCCTGCTGATCCTCACCGCGTGCGAGGAGGTCACGAGC
TTCGCCATCGGTCAGTCGCTCAAGAACTTCTTCCAGAAGCTGGGCTGGTCCAACAAGGGCTCCACGTCCATGAAGCTGACGTACGATTCCTTCAGCCAGT
TCATGTGCATCGTGGCCGGCTACATCGCCGACGAACGGCTGGGCAAGTTCAAGACGCTGCTGTCGGCCGCCACGCTCGACTCGTTCGGCCTGCTCTTCCT
CGTCATCGCCGCGCTGCCCGTGGTCGTCAACAACCACCTCGGCGTGAGCAAGGCCATCTTCAACGTCGGGCTGTTCCTGGGCGTGGCCGTCTCGCAGATC
TGTCTGCGGTCGCTGGTCATTTCGTACGGCGGCGACCAGTTCTCGCCCGCTGCTCCTCCGGCGGAGAAGGCCTTGTTCTTCAGCATCCAGTACTGGGTGG
CCAACATCGGCGCATTCATCGGCTATGCCGTGTTCCCGTCCGTGTCTATCCACGGCTTTGGGGGCATTCCGGCTGAGTACGGCTACGTCTCCGTCTACCT
GGTCGGCTTTGCCATGCTGGTGATCTTCGTGGGCCTGCTCTGGTTCACGCGCAACCGGTACGTCAACGTACCCCCCACGAAAGAGTCCATTGCACTCGTG
ATCAAGATCGTGGTCCACCACGCCAAAAAGAACTTCAACGCACAGATGGTAGTGCTCGGCACGGTCCTGTACATCGCCGCCTTCCTGCTCAACATCCTGG
CGTCGGTCTTGTCGGACCACGGCGAGGTGGGGCACAACATCTCGTACGCCTGCGGCGTGATGATCGTCATCGCCACGGTCCTCTGGGTCTACTTCGGCCA
GAGCTCCGAGTTCATGGAGTCGGCCAAGGACACCGTGGGCGGCCGGTTCGACCCCGAGCTGGTGGACGGTGTGAAGCAGGTGATCCGCATCCTCCCGTTC
AACGCCTTCAACGTCTTCTGGTGGGTCTGCCAGAACCAACGCGGCAACAACCAGTCGATCGTCCAGCAGACCGACACTCGCCTCGGGAGCGGTCCGTTCT
CGAGTCAAATGCCCGGACCCACCGTTCAGATGTTCAACCCCATTGGCGTCTTGATCTTCGTGCCCCTGATGGAGAAGGTGGTCTACCCGCTCTACGAAAA
GCACGCGGGAAAGCCCGCAAGTCGCTACGGCAAGGTGCTGGCTGGTTACTGCGTGGCGGTCATCGCCATGATCTGGACGGGGTGCTACGAGATCATTCGA
CGCAGCACTTCCCCGCTCACGTACGTCGACTCGGACGGCGTGACCCAGTTCATCCTGAACGACGACGGTAAACAGGTGATGAACGACATCCCTTGGTGGA
CGGCCATCCCGCAGTACCTGCTTGTGGCATTGGCTGGTGTGATGATCGCCATCCCGTCGTACGACATCAACTACTCGGAGGTGCCGCAGAGCATGCGCAG
TACGTCCATCGCGCTTGGATTCTTCGTCAACTCCATGGGTAGCACCCtgctctccatcatcgtgctgctcttcggcaagtacatcccgtccaacctcaac
aacggacatatcgagtacatgttcttcacgctggctgcggtcatggtggtgaatattttcttctacgtGGTCATTATGACCAAGATGCAGCTGGGTATGA
TCCCCCGCGTCAAGAAGGCTGGCGAAAAGGGGTCGGAAGAAGCCCAGGCAGGAGATGTGTAATTAAGTTTAGTTCTGGCTGTGATAATGGAGTATTTTTT
CATACTGTTATAAGCGAATCCGATTCCGT