Transcript Name :
Phyci_92422
Orientation:
(-)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-96
362-365
429-440
513-532
612-924
117-338
389-407
464-489
556-588
97-116
339-361
366-388
408-428
441-463
490-512
533-555
589-611
NN-scoreoddsWeighted Score
0.5193.8230.008
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        3295 bases(100 bases per row)
GTTAAATCACACTTTGGCATCAGATCGAAGATGCGGCCTTCCGACCGGCAgcgcggcgccgcgggggcggcgcTGGGCGACGGAGACGCTGAGGAGGACC
GCGTTTACCGTCCGCTGCTGTTCCAGTCCACGGGCTACGCGTCCTCGGAGCTCTTCCGCGACTCGTACGAGATGCACTCGCGTCTGCCAGCGTCATCGTC
GTCGACCGCGCCTCTATTAGGGGTAGAGACTGCTGCCACCGACTCGACCCAGAATCAGAAACCGAGGCATGTGTTCGAGCCACAGATACGACTCGAGACC
TTGTCGTCTCGGGCTGCCACGGCGGTGCTCTGGGTCACGTACCTGGCCTTCCTTCTGGCGATGGCACTGCCGTATCTGCAGAGCAAAGGCTACCTGGAAA
CGGTGTGTAGATTCAGATCTGAGGAAAATTGCTGATTCGGGGACTAAAATTTGTGTACATGTTGTGTAACTTCAACGTGCAGGCGGTGGAGTTGCCGGGA
GGACTGTGCAAGCCGAACCAAGCGAGAAGAGAACCATGTATGGAAGTGGACACGACAAAGAACATTGCTCAGTGGGTGGCGTATGTGGCCAACGTGTCGA
GATACACTGGTTCCGTCGAGATCAAATTGGATGTGCGAGAGCAAGTGAACACTTCTACGTCCGGTGCGTTGCTGTCGTCTCTTGTGGAGGGCAATACCTT
TCAGGAACTGGAACGCGTGGGTACTGCGTGGAAAATGGACCGCGATGCAACCAGAGTGAAGAGCAACTTAGAGGAAGAAGGTTCGGAGGTATCCGAGATT
GAGGACGGGGAAGTGGACCAGGAGGCGGGGTATGTCTTGACCTACGATGCCAGGCTGTATGGCATTGACCACGATGTCACTCCGGTTACGAAGAATCTCG
TCATAGATGAGCGCAACCAAAGTGTCTGGGTGGAGTGCCGTACGGGTGGGCCTTGCGAGATCGTGAGGTTGCTTGAGATAACCCAAAATGTTGATCGACT
GGTAAGAATGCTCACAATGCTTTAATTTGGCGCAAGTATGCTGGCTACAACAAAAACGACCCGAACTAATTTGTGTTCAACTCGTTCTGTTTCAGGGCGG
AAGCGGGTATGATGCCTATTTCGCAATTTTGACGTTCAGAGGCATGTATCCAAATATCTTCGGCAAAGACGTTGTCTATCAATTCGCTTACACGTACGGA
GTTTGTATTATTTTGAGCGAATTGAATGGTTGCCCATATCGTTGAGTGCTGACTTTTTTCATTTGCGACGACAGAAAGCCAGCTATACACATGGGTGAGG
TGATTGTGCGTGGAGTGATGGTCCTAGCGTCCATTCTAGCGCTTCCTTGCTGGTTCATCTCGGTTCTGAATTTTCATGGAGGGATATGGAGTCAAGTCCT
TGGCGTGCAAAAGTGGCTGCTGGGAGTTGGTGTCGTCCTTGTACTCTGGCAGAACCCAGTGTATGCTGTATCGGAGATGTATACTTCCGTGAGTATGCGC
ACACGGTTTGTTTCAATAACGTGCCAGTCATTTGCGGAAGCTTTTTTCTACGTATTCTGGTTGAGTCTCATGGACCAGCACAGCGGCGATTTCTCGTCTC
GAAGATGCGCATTTGCGCCGAAGTTGATGTTCGGCTTGATGCTTTTTGCCGTAGACACGGGAATGACTATGCTGCGGATGCCCAAACTGTTTTTTGGTTC
TGAAGTAGCATCATCCGCGCATGACTTTCACCACGAAGAGCTTTACGTCCTGCTAGGATTTATTCGAACTGGGTTCATTTTGGCGTGGCTCGTGTGGATC
ATGGCTGTTGGCGCTCGATCAGGGCGGCATTTAAAGGCACTTCCGTATATGGCTACTCGCTTCAAACAGCTATCTTATCGCTTCCTAGTGCTCGAGACGC
TTCTTATTTTCGTCTACGTGTTCGTACTGTCGGCCGTTCAGATTTTCTACCTAACCAAGACATGGTATTTCGTCGGCTACGATGCCTTTATCCAGGATGC
CGTACATACGTTTGCGAAAATGCACACTGGACATCCATCTCTGGGCAAGTTTCTCTTCTTATCGGTGTACGTGTATCTAGTGATGTTCGTTCACCTACCG
CCACTAGCGGGCGGCAGTACCGGTTTGCTGGCGTCAACAGCTTTCAACGTTGACGAGAAGCCACGGGTAGACTCTTACGGTTTCCTCACACCCGAATCGA
ATTTGTTCTGCGTTGAGACGTCTGGATGGTTGCTGGAGTTGGCATACCAGGCTTACTTTGATCCTCCAGGTTGTCCATCGCCCTCTGGGTATGGGGAACT
TACCCTCGAGCGATATGGATTCGAGCTTATCACTCACCTTCGAAGTAACCTCACAGATACCCATGCTGTGGTTGCGTGGAGTCAAGAAGATCACCGGCGA
CTGGTGATTTCTTTCCGGGGGACTACCAGTAAGGAAAATTGGAGGAGCAATCTCCGTGCTGACCAACATGTACTGTGGATAAAATCCCGAGGGCTTCGCT
GGAGAAGGTCATGTCTCGAAAAAGTGAGGGACGTTGCAGCAAAAATTCCCGTGCTGAACATGGCTCTGCCGCGGGTGCACCGAGGTAGGTTCTTTTGTGC
TTGCGTGCCGATACTTGGATGATGATGCTGCTCATCTAATGTTCTTGTGGTTGAATAATGTCAGGGTTTTGGATTGCTTACGAGTCGATCCGAGATCAGT
TGAAGGAAGTGACACGGCTGATCCTAGACGAAAACCCCGGTGTGTCGGTGTATATTACAGGCCACAGTATGGGTGGTGCATTGGCAATCTTAGCTGCCTA
TGATCTGGCAGTGAATTTCAGCATCAAAGTTAACATGTACAACTTTGGCGGGCCTCGCGTTGGAAACCCAAGCTTTCGTCAGCACTACGACAGTTGTGTA
CCTACGAGCTATCGCGTTGTCATGGATGGTGACATCGTGCCGGGATGGCCAAAATTTGTACGTGTGCGTTGCTGTTGCATGAATGGGGCACTTATCTAAC
TGTTTGAATAATTCGTTTTGGCAACAGTGGGGGCTCTATCAGCACGTGGGGACTGAAATCTCGCTTGATGTCGCGGGCAACCTGATCGTCGATCCAAGCT
TCGTAGAGCGTCACCTCCACAATTCGTCGAGGCGCAAGACGACAATGCATGGTACAAATGTCTACCGCGTGTCGATTGCCAAGTGTCTAGAGAATCTGAC
GACGTCGTAGCCAGCCTTCAGGATTCGCAGGTGGTGCATTTAATGACTATATATTGACGCCGCTATGTTGCCTTTTTTACTCGAGTGCGTTCCGC