Transcript Name :
Phyke_g463
Orientation:
(-)
Number of Exons:
35
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat6.3PR01415
Ankyrin repeat6.3PR01415
Profile scan predictionP-Valprediction_id
Zinc finger, RING-type12.091PS50089
Ankyrin repeat-containing domain37.825PS50297
Ankyrin repeat9.324PS50088
Ankyrin repeat13.33PS50088
Ankyrin repeat14.185PS50088
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type1.7SM00184
Ankyrin repeat510SM00248
Ankyrin repeat3.4SM00248
Ankyrin repeat4.2SM00248
Ankyrin repeat1100SM00248
Ankyrin repeat1.3SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
Y-scoreD-scoreY-pos
0.7270.80619
InsideOutsideTMhelix
137-194
250-279
338-638
696-707
757-810
866-895
983-988
1082-1085
1165-1216
1267-1302
1-113
213-226
303-314
662-675
731-733
829-842
919-959
1012-1058
1109-1141
1235-1243
1326-2695
114-136
195-212
227-249
280-302
315-337
639-661
676-695
708-730
734-756
811-828
843-865
896-918
960-982
989-1011
1059-1081
1086-1108
1142-1164
1217-1234
1244-1266
1303-1325
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        14597 bases(100 bases per row)
atgttcttgtggaagatTTTCTTGACCGCGCTCGCATCTCGACTGTGCACAgcgtggcagaacgaacacttatacgtgctgcttcctccaagatCGTTTT
TGATCCCaccgcagctggaacaggtaCTCTTCCTCGCACTCGATCACACGTTCGCCAACGCGATCTATCTTGTACTCAAGCAACGttttgaacttgaagt
gtGACTGTGCCAACATGACttgtgctgtcgaagacTGAATCTTACATGACGAGAAGGCTCTCTTGTGGTCTCTTCCATGATTTCgtcagatgaagacaac
ggCGTTCCGTCTGCTGTAACAACTTGCTCGTGCTTCCTCACCATCTCCGCGGTCTagaacgacggcagcagtaCTTGGTTGTAGTTAGCAGCCAACTAGC
TTGAGAGCTTCTGATGCATGTCGTTGACCATCCGAGTCACGTGACAATACGTGAAGCGGATACgttgtcgaagacgatgtcgctcacgatgctgtttgct
cttcGCTCTactcttggtcttctttCGTTGTCTTACCCTTGCTgtgctcttggtcttggtcttcttctccagtaACGCTAGCTTGGATTTCATTGTATCG
ATGACTCCAAAGCGCCGCTTCAGCACCATGTACGCATCCTTGACGGACAACGTCCGTCCATCTCGATCGTAAACGGTACTGCTATCCCTCTGTCAAGTAT
CACGATCCTCGGTGGTGGTACGTGAACTGAGTATCCTGTCGTTTGGTCATTCTCATCTTGATCATGGTTTAAATCTTTTGCTCTTTCAGCGATCGGCAAT
TTGTCCCTGAACCTTCGCCGTACACGAGAGAACTCGACTGAGCCTCTCATCGACTGGGACGTCATTCTTGTGATGCAACCACTGCTCTTGTGTACGTGGC
AGCCTCATTGTGACGTACGTGTGTATGGCCTTACAGTGATGACTCACTCACGCGTTGTGTGATACAGTGGGAGCAACTTGTGGGACCTTCCTCAATACCA
TCATGCCAACCTGGCTGTTGTGCAtcttgttggtgatggtgttaAGCGTCACTGGCACACGGACCTTACAGAAGGCTATTAATGCCCGCCAGAAGGAGCG
GTGGCAGTGTGGCGTGACACCCGAGTCGTCCGCACTCCTAGGAATCGAATCCTCTTCTATCGACACTATGAAGGCCGACATCATGTCTAAGCCAGAGATT
GAACCTCGTGTCGATGTGCCGTGGAGGAAACTCGGGGCCCTTGTAGGGTTATTTGTTGTCATCCTGACAATGAACGTACTTCGAGGTGGCAAGGGTTTTG
ATAGTCCTGTAGGCATCGATTCATCGTCGGCGTGGTACCATGTGCTCGTCGCATTGCCATACGTCTTCCTTATCTGCATGAGCTATTTCTCGCTGCAAAA
CTTGGGAGTCACATAtcaaaagcagcagagcacAGGATATGAGGTCAAGCCCCACGAAATTGAGGTATGGAAGTAGGTGATACCAGTCTCTCACTTACTC
CATCAAAGTCTCATCGTATGTATCATGTCAATGCAGTGGACATCGGCTTCGATCCGGTACTTCCCGATGTTATCGCTCGCGGCTGGGACGGTCTCAGGTA
TGTTTGGTATCGGCGGAGGCATCATCAACGGCCCTTTGTTACTCGAGGTGGGCATTGATGCCTCGGCTGCCTCGGCCATGACTGCCACGACCGTGCTCTT
TTCTAGTGGAAGTACGTCCTACGTACAgtatttgtttttttttgtttttatcCTCGGCAATATGGTTAGTTTTATCAATGTCTTGTGCGCGAGGACTTGC
AATGTCTTGGAGAAGTTGCTATATCGATAGTAgtgtggttgaagtgcagGTGTATGATGATTGGCCGAATGTCTCAGAATTGACAAGTAGCAAATGAGAC
TCAAACCAAAAATCggcacaagaagcagaagaaaaatgACACTTCCTAGCACAGATGCCGCCGTGTTCCTGGTGGACGACGCCATCTTCTCGGCCAGTGA
GGCGCACGTCAtgacggaggaggagcagctGGCTGTGATCCAGCCGCGTCCGATGGACGAGATCCTTTACATCACGTCGATCTtggctcagcagcgtcaa
tTCCCAGTAGATATTGTGAACAACATCTTAGAATTTGCGGGTGTGCTATTGTCTTTCCAAGCAGAGACAACGGAACATATTCGAGGACGTAGCGACATGA
ATGAGGTCtatctgcagctgcacctACCGACTGCTGAGGAGCTTCAGGTTCCTACCGGAGTGAACCTGAGCAAATGTGCACTGGTAGTCGCAGACTGCAC
GTCGAAGGACCAAGGCTGGGCTACAGACGGACGGGAGCACAACGGTACGTACCGTGGCTCAAGTTCCTGGAGTGAGATCACAGTGACGTCGACGAATGAA
GTGGGGGAGGACAGGGAAGTGGCTCGTGTGTTGTTCGGTCCGAACCTTCGGGCGGGGCGGAATTTCCGCCATCATCGCAAGTATTTCAGCGGGTCCACGC
CCTTACTGGAGAATATTCAGATGGGAGATACTGTAGCGATTGTACTTCGGTCGCAGTATCCAGGATGGACGAACACTGCGAGGTACGCCAGGCTCGCGGT
CTGCTTTGCCGTGGAGTTCACGGACGAATTCTCATTCGTCGACATCCCGTTCCCGGACAGAGCGAGCGAGACTCCAGTGGAGTCTGAATCCATGATCTCG
TGCTGCATCCAGTaggtggtgctggaccgACACAAAGTGGCAGCGACCAAAAGGATCCTCAAGTATTTTAAAAGGTTTAACGGCTTGGCACAATATATTG
CTCGTTTTGTGTGATCATTCTCTGCGTAGTTGGCTAGGGCCTGAGGTTACAGCACGGGTGATAAATGGCCGTGGCGAACAGAGCATAAGAGCGGGTGTGA
GTCATAGGCTATGACGCATGAAGCAAATAGATTCGACAGTCGTGTCACACAATCCTCTCCCGCGACACGAGATCTTGATCGTTAAACAAGACGGAGAAGT
GCAGCGAACACGCGATTGTCGTCCAAGCGAcattgtgctgctcatcaaTTATGCACTTGCCAGCGTGAGCTGTTCTAAACCTCGACTATGATTGGCCATG
TTCAGGTGACAGAGTCCCATGGGAAAGATTGGCGACTGACCCTGCGCTTGCAGGTTACTTCCGGTCTCGCTGCCTCGAACGCAGTAGGCAACAGCGACCC
CAAATGACGCGAACGGGTGCTGCAATGCTAGTAGCATTCAGCTTCGTAGTATCGACACTTGTGGCTGCGCATGCACAGACGTTGCGTGGAGAGCAGGCTG
TGACCACATCGTCTCGCGCTGACGAGGCTGTGGTCCCAGAGGTCGACGCGCCCGTGTCCTTGGCCCAGCGCGAAGTCTTTGGTATGGCGTTAGCAGCACT
CGTGATctttgtagctgctggaggaggcactggcggcggcggcgtcCTCGACCCGATCTACATCCTCATCATGGACCTCAGCGCCAAGGTGCGATTTACC
GTGTTTAGACAGAAATGACTGGGGCGCTGACTAGCATACAACTTTTCGCTGTTTGGATTCTCCTAGACTGCTATCCCTCTGTCAAGTATCACGATCCTCG
GTGGTGGTACGTGAACTGAGTATCCTGTCGTTTGGTCATTCTCATCTTGATCATGGTTTAAATCTTTTGCTCTTTCAGCGATCGGCAATTTGTCCCTGAA
CCTTCGCCGTACACGAGAGAACTCGACTGAGCCTCTCATCGACTGGGACGTCATTCTTGTGATGCAACCACTGCTCTTGTGTACGTGGCAGCCTCATTGT
GACGTACGTGTGTATGGCCTTACAGTGATGACTCACTCACGCGTTGTGTGATACAGTGGGAGCAACTTGTGGGACCTTCCTCAATACCATCATGCCAACC
TGGCTGTTGTGCAtcttgttggtgatggtgttaAGCGTCACTGGCACACGGACCTTACAGAAGGCTATTAATGCCCGCCAGAAGGAGCGGTGGCAGTGTG
GCGTGACACCCGAGTCGTCCGCACTCCTAGGAATCGAATCCTCTTCTATCGACACTATGAAGGCCGACATCATGTCTAAGCCAGAGATTGAACCTCGTGT
CGATGTGCCGTGGAGGAAACTCGGGGCCCTTGTAGGGTTATTTGTTGTCATCCTGACAATGAACGTACTTCGAGGTGGCAAGGGTTTTGATAGTCCTGTA
GGCATCGATTCATCGTCGGCGTGGTACCATGTGCTCGTCGCATTGCCATACGTCTTCCTTATCTGCATGAGCTATTTCTCGCTGCAAAACTTGGGAGTCA
CATAtcaaaagcagcagagcacAGGATATGAGGTCAAGCCCCACGAAATTGAGGTATGGAAGTAGGTGATACCAGTCTCTCACTTACTCCATCAAAGTCT
CATCGTATGTATCATGTCAATGCAGTGGACATCGGCTTCGATCCGGTACTTCCCGATGTTATCGCTCGCGGCTGGGACGGTCTCAGGTATGTTTGGTATC
GGCGGAGGCATCATCAACGGCCCTTTGTTACTCGAGGTGGGCATTGATGCCTCGGCTGCCTCGGCCATGACTGCCACGACCGTGCTCTTTTCTAGTGGAA
GTACGTCCTACGTACAGTATTTGTTCCTTGTTCGAGCGTATCATCTCGGTAACGGATTCATTGTTTTTGTCAATAGTGTCGGCCTTCAACTACTTGCTGA
TGGGGTCGATGGATCTGCATCTCGCGCAACTAATGCTCCCCATGGGCTTCCTCATGACGTATGTCGGCCACGTGTGTCTGCTAAAGGTTGTGCGTCACTT
CAACTGCCCATCGCTCATTATCTTCTCCATGGCCACCATCGTTCTCATAAGCGCTGCAGCCATGAGTGTCGAAAGCATTCGTGCACTAGTCGACGTGTAA
AATCATCTTCAATATATATTTTCACCCAATCGTATCACTGATATCttcttttcaaccaatcaaaatgtTTGCAGAAGTGTCATTCCCAAATTCGCTTCAA
GATAAGAGGAGGAATATGATGTGCGCCATAACCGGAAGAAGTGCGTTCGTTCGCGGTCTGGCAACGTTGGCGCTCGCTTTTGCAGTGGTGACCTCTTATC
TACCTGAAGAAGGGGAAAATCCTGTGAAGTTTGGTCCTGTCCCGACGTTCCCGACGGGCGAAGGACCCTACGAACCGCACGAGACCTTTCGCTTCATGGA
GCTCCCGCACGAGACAATCGGCAttgtgctggctgcactAGTGGTGCTTATTGCATCAGGGGCGAAAATCGGAGGTGGGGCTGTGCTGGACGCAGTCTAC
ATCTTGGTGTTGAGGCTACCACCGAAGGTTGTGCTGTCGAATATCTCAGTATGCCTCTCTCTTAACCTACGTTTTGTGTTGAATTATTTAGGAAGCTATT
CCATTAGCCAGTGTTACGATATTTGGAGGAGGTAAGAGCGCCTCTTATGAAAACTGAAATCGCGGCTCGTAACATTGAGTTCTAACGGTGGGTTACcgtt
gttgttggttctGAAGCTTTGGGTGATATCCTGCTAAATatctggaagaagccaaTTAATTCGTCCAGCTCGCTGATCAATTGGGACATGGAGCTGGTGA
TGCAGCCTATGCTATTGAGTAAGTTGCGCCTGCTATTTGGCTCTGGTACTTCCTTCGTGTTGATGATTTTaactgtttgttgttgtagtggGAGCAGCGT
TTGGGGCGTCGATTATTTCGTGGTTTTCCTCTTGGCTCTTCACTATTGCCCTGATTGTGTATTTGGGGTATATCGCCAAGAAAGTTTTCGAAAAGACTCG
TGCTGTTGGGAGAGACGAAAACTGGCGGTGGTGCAGCTCTCGCGAGGCGGTGTCACTGCTTGGCGCTCCGTCTTTCAGCTTTCAGGTGCGTTATTTTAAT
GACAATACTGGAATACTTAGCACGCTGACCAATGCCATGTGCTGGTTAACTAGGACGATGGTGGGTTTCAGTACAAATTCAAGCTGCCTTGGCGCAAGTT
GGGGAAGAACTTTGGTCTATTCGGTGCCACAGTGCTGCTCACATCTCTCCAGGGCGGGAAATATTTCCCTAGCCCGCTTGGAATTCCTCCaacgtccttc
ttctttatcatcatctctctGCTGCCGTTCATCTTCCTCTCGGTTGTATCACACTACCAAATGAAAGACGTCGTGGCTACATATCAACGACAGCAGAACC
CGCGGTTTATTCTTACTTCAAACGAGGTTCAGGTATGTTCCGCTTAGCTGTCGTATTTCAAGCAACTTGTTGACAAAAGTATGTTCCTTAAATGTGCACA
GTGGTCACCAGATTCTATCAGGAAGATTCCTCTTCATTTGCTTGGCATTGGAGCGCTTGCAGGTGCGTTCGGCGTTGGAGGAGAGGGCGCCACGTCAAGC
TTGTTACGCAAGGTCAATTTTTCATCGGCGGCGGTGTCGGTCATGTCTGCTACGAGTGTGCTTTTTGCAAGCGGCAGTAAGTATATAGCTTTGTATTGTA
CATGCCTTGCTGGGTGGTTTCTAACGTGAGCTTTGCCTGTCATATTGAAGTGGTCTCTTTTAATTTCTTCCTGTGGGGTAAACTGGACCTGGACCTAGCA
AAGATCATGCTACCACTTGGGCTCGTGATGACACTACTGGGACGTACTTGTCTTGCGAAAATTGTTCGCAAGGCCAAATCCCGCACTCTCCTGCTCttcg
ctgttgttgcagcgaTGTTAATCAGTATCGTGCCACTCAGCTTCAACGTCATTCGTGCCATATTCAGCATTTAGGTCCCATAAATGGCGAAAAATAAAGG
TGCGGAATTATCCTCCGTTTTATACCTCATTTTATTAATTATTAGTTCGCTATTTGCGCCTGAAGAACGGCATAACGCGGGCTTCAGTGGAGGGGGGAAG
CGAAGATCCGAGCGGACGGCGGGGCCAGCGGAGGCAGAAGGAGCGATGGCGGACAGCGGAACGCAGACAAGGGAGAATGGCGTGAGTCACAAGAAGAGAC
GGGAAGCAGGCAGGTCTCTGGGAGGGAGCGAGTCGGCGTCAAAGAAGATTAAACTGGAGGACACGACGCCGCCCGAGGTTCGAGTCTTTTTCTCGCCTTT
ATTTCCTCTTGCCTTCAGTATTGACGATGTCTTATGATACTTCAGGCAAACCCCAACACAATGGAGGCTGTGAGAGAGAAGAACAGGGCGCTGGAGATTG
AtatgaaggagaagaaccGACGCATCGCGTACCTGACCAAGACATGCGAAGCTCTGTTCCGCTCTCAAGGGATGGCTGGAGCTTCTTTCCGCTGCTTAAG
AAGGCAATGGTTCCAGTTACAGGATGAACTATTAGCTGCAGTGAAGACTGTAGACCCCTATGCTGTCTCGGACGAGACGTCTAAAGAGGTGTGGAGAGCA
GCACTAGATGCGGTAAACGACTTCGGACAGGTCCGCGTACGAGCAGATGAGCTCAAATTAAATCTGCCAGAGTGGTTCCTCACTGTTGCAAGAGATGCAG
ATACAGAAGAACCAGATGCCGATGTGTCTTTGCATaccgatgaagatgcagctaGCAACACGTatattgatgctgcagatTTGACAAAAATGGAGCGTGA
AGTACAtggacaacttcagcagaagagcgaggagatgaagcagcttttgcagaAACTGCTTGGAGTAGTTGGAAGTGCTTCTCAAGATAAGACCAAACTC
ATCGAGTATGCACATATCATCCAGGAGAAACGTGCAGCTGTGGCGGAAACACTAAatctgaagcagcaattACAAGCGGTACGTTTGGCATAGACATTCT
ACCGAGGTTTCGTGTCGTTTCTGAGTTAGATCTGACTTGTGATGCTTTGTGAACAGTGCAAAACGTGGATCGCGCGTCTCGAGTATGATGTAGAATTCAA
GGAAGCAGAACGCCACCAGGCATGTCGAGATTACGATCGTCTAAGCGCGTTTGTAAAGCGGCAGGGTGGTGTAGAAGGCAACAGCGCGAATGGGGAGGAT
ATTAAAAACGAGAAGGTTGCAGATGACGAGAAACCACGCGAGAAGGATACGGTTGCCATGGTGAACCAGGAGGAGTTAACAAAAAAGGAGGCAGAACATG
CTAAGACCGTAGCAACTTTGCGGGACAACATGACGATCTTAAGTACAAAGTTATACCAAGAGCGTCAAAAAATGGACTCCATGCGCCGCGAgctggacaa
gttgaaggcTTTGGAAGCAGCGGTATGTAAACACAAGGTCATAGCCAGCATCATATGTTGAATGAGTTGGGTCTAACATTTGTGTTGCCTTGCGTCGATC
AGTGGGAAAATGATGAGAGCACATTGATTCAAGATCACGAAGAAAaattgaagcagctccaagatgAAAAAGCACAGGCCGTCGACGAGTATAACAAGAT
CCAGCACAAAGCAAAGGTTAGCATTTTTTGGTATGTTCACCTCATTGTGCAATTATTGACTGATCAATTTTGGTTCTATGTTGTTTGTATTTTGTGGGGA
TTAGGATGTTGAACACCACATGACAGAAAAGTGGGAGAAAAAGATTACAAAGATCCAAGCGGAAATGAGCAAAACCAAGTCGCAGATTGACGAGGTGAAC
TTAAAGAATGTGTCGCTACGAGAGAAGCTCTCCAACGCTTCTAATTATCGTGACCAGGTGAGAAAGCATTCCCAATGAACACCAGTGTATGTTGCGTACT
GGAGATTGTTAACAATGGAGCGCTTATGCTGTGCAGCTAACGGAAGCAAAGGCCGAGCTTGAATCTGCGAAGCGTGAAAACGTAAGTTTGAAGGCAAAGG
TCGAGCGAGAGCAGAGCCGAGCGGACCGGGCTCAGGCCTCTGCAGATAATGAACAAACCCAAGAGCTGACACATAAGGTGAGGGCTACTCCATTTCTATG
TGTATTGGAAAGGGTACATTGTTGCAGTTCGGAGCCTAATAGCTGATGTCTTTTCTAGTTGGCTTCGCTGGAAAAGGAAAAGCAGGAGTTGCAGCAAGCT
TATGACACACTGAAGCAAACAGAAATGTGCGCCTTGTTAGATTTATTGCTAAGCGGTGTGATTTCCCCCATTAATTCGACGTTTTGCCAATGCTATCACG
TGCTTACAGGAAAAATGCCACTGACAAGCTTTCCGATGCGTTGAAGCGACTATCGGAAATGGAGGCGAAGTATCAGCTAGAGCTGCAAGAGCATCACAGG
TGTAGTTCTGACCGAGAGAAGTTTCGTGCCAAGATCGAAGATATGAAAGCTTCCAGTGAAGCATCTCGGGAAGAAAatgatgctcttcttctggagaTTG
AGACGATGGCGAAAGATTTGGAGTCAATGCGGCATAGCCGAAAGAAATTTGTCCAGCAAATTGAGGAAAAACGAAATTCatgcaagaagctgcacacTCT
TCTCGCGAGAGAGGAACAGGCAAAGGCCCACTGCTTTGAAGAGTTGGCTGCAGCACGGCTGCAGGTCTCGTCGTTGAGTACTGTGCACAAACACCAGAAG
GCGTTCCTCGAATCATCTGAGGTAGGATTTACAAAGTATGAATGCGTAGTGCTAGCAATGCAATGCCCCTTACTAACGAATGCTTCTGGTGAAAATGTGT
GTCAGGAATGCTTGCAAGCGAAAGCATTAGAACTCGAGAAAATGAAAGAGTATGTGAAGACTATCGACGCAGAGCGCGAGGCCTCCGATGCTGAAAAGCG
CAAAGCTTTACGTGATGCTGAAGTAGCCAAGAAGATTGTTGCGagttctgctgcagagtcaacgcaacgccagcaacagatGTTGCAGGAGAAGCAACGG
CCATGCGAGAAATGCGATACATACCGCAAGAAGACAGAGAAATATGAGCGCCAGCTACAGAGCGCCAAGTCAGCCTCCTCTACAGGCGAGCTTACAGATC
TGGAACGATTCGAGCTGCGTGACTTGCAGAAGTTGGTGAACTGTTCAGTGTGTCAAGATCGACGCAAGGACGTGATTATCTCCAAGTGTTTCCACATGTT
CTGCAAGGAGTGCATTGAGAACAACCTCAAGTCGCGCAACCGCAAGTGCCCGACGTGTAAAAAGATGTTCGgccacgacgacgtcaagaCCGTATGGTTC
ACTTAGGTGATCCGCATCGCGCCGCTGCATAGGTGGCGGCTGTGGTGCAGATCGACGGTTAGCTAAGCCTGTTGCATTAAATGTAGAGGAGTTTATTTCA
CGAGAGCTTCTCGACAAAACAGCGGCCTACCTTACTCTACAGTCATCTACATGTACTGCCTATTCTACCTGTTCTGCCTACTTAGAATTCGGTAGACTAC
CTATTCTACAGACTACCTATTTTACAGACTACTTGCTCTACAGTTTACCCACTTTGATTGGCAATGGCTCGCAAGAACGACACCTCGCGAAAGCGGCGGC
TGTCCGACTCTCGTAATGGTCCCAACAGTTCCAAGCGTCAGCGTCAGAGTACATCAGAAGTACCCACCACTTTATATGCAGCTCAGGACGACGTGTTAGT
GCTGGGCGACGGCGATTTCTCCTTTTCCCGTGGTCTCTCGAAGCACCGCGGCACTGGCCGAGGTCTCCTCGCGACCTCCTTCGACTCGGAGAGCCAAGTG
CACAACAAATACTCGAACGCTGGAGAGTGCATCAACGCTGTACGCTCGGCCCATGGCCTGGTAATGCACGACGTGGACGCCACCAAGTTATTGGCGCTAC
CCCGACAGGTCAAGACTGGCGCGGGGCTACAAACTGTGCCCGATTTCTTCCAATACATTGTGTTTAACTTCCCGCATAGTGGACAGCAGAGAGTGCACGT
GAATCGAGCGTTGCTGATGGACTTCTTTGAGAGTGCACGGGACCGACTGAAGACCCACGGAGAAGTTCACGTGACGCTGAAGACTCGCCCTCCATACTCC
AACTGGTTCATTGAGGACCAAGCCAAGGTAGCTGGGTTCGTGCTTAAGGAACGACGCAAGTTTAACATCCGACTGTTTCCTGGTTACCACCATCGGACGA
CGGACCCACAGGCGAAGAAGTTTGAGCCTGACCTTTGTGTCACGTATGTGTTCGTGGTCAACCGAACAAAGGTACGTAGATGTCTTTATGGTCATTATGT
GGTGTTGGTGGGAGTGCTCACTTGTTTGTCGCTGGTTGATGTGATAGTACCCCTTTCAAAGCAGTCGAGCTGCCCTGGATGCGGCAAGTGCCGAGATCGC
GACAAGTGCAGcgactcagcagcaggaattggCGGCAGCAATTCTCAACATTGCGCAGGctaatgctgctgctaataAGCACCAGAAACAAGAAGATCCT
GTGAAGGTTGCTCCTGATGGGATTGTAACCAAACTGCCAACTAAGAGCAAAGGCAGGAAAGCTACCCGTCGCCGTTCAAGAAGTGATGCAGCCCCGAATA
GTAGGCATGTCGTGAATGCCAGCCATGAAAAAGTACCCGATGTCACCCTTAGTACTTTTTCGAGCGCGCTATGGAAACCGCTGCACCGAAAGTCTCATGG
CATCTTCTAGGATATCAGACGACTTTGGCCCAAGCAGAAAGCAATATGCAACACAATGTGGCATCAATAGATTTCATTTTTGATTGACTACCGACATACA
GAACACGTCTTCGGGTGAGACCCCGTCCCAGGCATGTCGCTCTGTATTATTGTTTTTGCGGGTAGTGTGCGTTCGTCGTTTGCTGGGAGAATTCTGCTGA
GACGACCAGCTCTTCATTCTCATTATTTCCCTGCGTCGTAACAGCAACCGTAATGATAGCAACAATGGGAAGAAAGTGTGTGATCTGTTGCCATCGCTGC
TTTGTATATCATTACATTACGGTTTAAATACCCCCTCGTCGCACAGGCAGAACAAGCGCGAAGACTTGAGACTCGGCCTAGGCATGCCTCGCCCGTTAGG
TTGGTTGATCATAAGTTTAACGTTTGATCTCCTTGCTTTCACGGTTAATAAGACAGGTAGCAGTCGAGTCATCTTACTAAGTACCAGGAAGTCCTTGTAA
TAATACTTGCCACAAGGACCCCACTTAGCAATGAAGACTCTATCTCTTACTTCAAAGTATGTCACTATTGCATGTCCACAACTGGCTCAAATTTTACCTA
GCAACAAATCGACCTTGGCGAGGCGCTCAACGAGCTCCATACAATGTTCTTGCCAGATGAGGTGGAATGTGGCAAAAATTAGCGAGATGGTGCTCCAAAA
CTTCCATTTGACGTGCCAGAGATGCATGCGGCCATTTAAGATGACCCGCAAAAAAAATTATCATACGCGAGGAACTTGATTTTTTTCAAGACGTACCACC
TTAAAGATTCTGTGCCTAGAAGCACACACTTGTAGGCAGTAAATTCAGATCTTCATGcaaaccaacaacaacaaaaatgtcTACTCGTCAGCCTGCCGCA
GCGTGAGCACCAACCTCTCTTCCAACGTAGGCCTCAAACATTGCTCGCAAGACAAACAGGTCAATAGAGACTTGAGGGTTGTCGAGACCAGACAAAGCTG
TTGGTAGAGCAACGCCAAAGTAAACTGTTGTAAGTGGGAATGTCAACACCAACGCAGGTAGATGCCGACAATTCAGTCCAAACTCCACTTCTTGAATGGA
CTGACCACGTTGGTGTAAAATGGCAACTCGACGCAGCGGAGTAGTTCCATCAGCAAATATCTTGATTCCGATCGTCACTTGCACAGATGTCCACCTTGGA
TCCATCCAGCGCTCAAGTTTAGCACGAAGTCTCATCAACTCGTCGTTCCTGTAAGCAGCTTTAATGACGACATTTGTAAATGGGAAGCCGCCTTCAGCCG
CCAATACCTCTCCTCCGACAGTGAGGTCCACAGGCGTCAAGCTCCGATTAGGTTGTTGACCATAATCTCTGATGACACAAATGAGTCTTCTAGGAATCAC
AGTGCCGATGGTATTCCCTGCCCGTAGGATTTGTGAGATGATTAACTGCTCAATCGTGTTTGCTGTTCTTTCGTGAACGCCTGACGGAAGGCTGTAGATG
ACCATTCTCCCCATGCCTGTACCATCATCGGAAGGCTCGAAGCACCACCGTCGCACCCGTCCGAAGTTGTTATCGATCCATCGTTCAAAGTCTTCCCACG
TCACACAAGATAACCGGACCCCAAGAAGtgtctccgtcttggtcGATGAATGGTGCATTGGCAGGTGGGTCGTTCGATATCGTTTTCAACTTCGTGCTCA
CCTCGTTAATGTCTTTCACGTGAATCACACACATACTTGCCATCGCTGCCGCTTAGCGAACGGTTGGTTGCAATAACTCCAGCGAAATAACACTGAGCTT
TGTTGGACAAAACTTGTAATGTCACCACACATCAATCATTTGCTACATGGCAAGGAAAAACTTTTTCGGGTTACTCGATACCTGAGAGACTCAATTCGAG
TCACTTGGGTTTTAGATTTGTAATCAGTAAATATTTTTAGATTTTAGATATTTGACCTTGTACCAAGCGGACTCACGACGATGGAGACCGATACCTGTGC
TGCCGTGAATGACGACAACGTTCCTAAGCTGCGTGCACTTCTGGACGCTGGCACCAATCTTGATctcaaggacgaggatgagCGCACGCCACTGCATTGG
GCCTGCGCCATCGGCCGTCTGGAAGTCGCCGAGTTCCTTCTCGAACACGCCAAATCCTCTGTGAACGTCCAGGACGACTCTGGCTGGACGCCATTGATGA
GTGCCGCCTCCGCTGGACACGGGGACATTGTgggtttgctgctgagcaaGTAGGGAGACAAATCATTGCATTCGGTTACTCAAGgaattgctgcatcttg
gcctGACTGAATGATATCTGCACTCTAACGTAGAGGAGCTGATGCGAACCTCGCCAATGAGAACGGACAGATTCCATTGCACTACCATCGAGGTATGACA
GTTGTAGTTTGCATTAGAACATTATGTACAATCAGGACAAGCTGGATTGACGTATATGATACTTTTGCGAACAGGGCGCCAAGAAATCGCGGAATTGTTG
CTGGACTACACGCAGAATGCCAACCAAGCAGTGCGTTATGGCTTTTTAATCCCATTCCTGGAGTTGGAAGGATATTTCGTGTGTCAGTGCATTTATTTCA
TTTATGTGTTGTAATATTTGCTACAGGACAATGTCGGGAGTACGCCGTTGACGCGTGCCTTGGGCGGCAAACCGAGTCCAGGTTCGATGGCAATGCTTTC
AGCCGTTCTGTAtcatttgctgttgtttttggACTGAACTGTTGTGGTCTACCTTTTGATTTTGTAGCAATTATCGCTCTTCTGCTTGATCACGGCGCGA
AAGTCAACACGCGCGATATTGCAGGCAAGTTGTTATCGTTACCTATTGTGCGATTTTTGAATTACTGTGCTGACGGACTCGCGGTGACTTAATTAATTGA
ATTGTGTAGGTAACACACCATTGCATTTGGCTATTACCGAAGGCTACGAAGGTATCGCCCGAttcttgctggagaacgGGGCTAATCCGAATGCAAAGAA
CCTAGATGGAGAGCGCTGCACAGATTTGGCCAAGCCAGCGTTCCGAGCAGAAATTCAAATGCTCAAGGAGAAAAAGAAAGGAAGTGAGCACCCATGA