Transcript Name :
Phyci_79847
Orientation:
(+)
Number of Exons:
8
Description :
myosinlike protein putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
CBS domain9.088PS51371
CBS domain11.182PS51371
CBS domain9.823PS51371
CBS domain10.241PS51371
HmmSmart predictionP-Valprediction_id
CBS domain7.9SM00116
CBS domain2.1SM00116
CBS domain3.4SM00116
CBS domain3SM00116
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
531-533
1-507
508-530
NN-scoreoddsWeighted Score
0.5543.4410.007
*** None ***
TypeScore
nuclear304
GO
*** None ***
*** None ***
*** None ***
Sequence
        2412 bases(100 bases per row)
ATGGTGTTGGAGGGTGCCTGATTCATACTCGACGGCGCGATAAAGGTTTGTTCTCGGAGAAAGCGCTGCATTGCAATACAAGAGCTTGAAGGGTTTTGAG
CCCAACGTCGCTTACGCTTTAGCTGCGTGGAGCTTGCTTGGGCAAGAAGTCTGTCTCTTGAATCGTTCCGAAACTGTTCCTTGGCCTTTGCTGCAAGCAC
TTGCTGCAAGCACCTGGTGCTGGTTGCCGGACGATCAAATTGCCGCAGAAACCCCCGCCAAACTCAATTGAACCCCCAACCCCATTTTTTGGGTTTTGGT
CGCGGATTCTCAGGTCACAACTGGGGCAGCGCCGATAATGCAGCAGCAGCGCGAGAAGGAGACGCGCAAGCCTCGCCAGCAGCAGCTCGTGTTCTCCACC
AAGAGGGCGGGGCGCAAGGCCAAGGCACGTCAGCAGCAGCAGGCCCCGGCATCCGCGGAAGACGCGAAGCCCGCGTCGCAGAGCAGGCTCGAGCAGCATG
AGACGAGCGCCTCGCCCCTAGACGCGCAGGAGCGAGCGCGCCACCGCTCGAGCCGCAGCAACCACGGCCACAGCCGCTCCGTGAAGCGCATGCGGCCGTC
GCGCGCGCTGCTGCAGGGCGACCACGCGACGGTGGCGCAATGCGTGCGTGCCATGGTGGAGCGGAAGACGGACGCCGCGCTGCTCGTGGACAGGAGCGGG
CTGCTCACAGGCATCCTCACGGACCGAGACGTCGCCGTGAAGGTGGTGGCGGTGGGCAGAGACCCCACGCGGACGCTGGCGTACGAGGTCATGACGCCCG
ACCCGTCGTGCGTGTCGGCCAATGCCAGCGCCATCGACGCGCTGAAGAAGATGATTTCGGGACAGTTCCGCCACTTGCCAGTGACGGACAATGACAAAGG
TGAGGGGGGAGGGAGAGGAGAGTGGAGGGGTGATGTGCGTGAGGCTTGACAGTGTGTGGGTTTTTGTGGTTTGTGATCTGTAGTGGTGGGCATTCTGGAC
ATTGCCAAGTGCCTGTATGAAGCCATCGCGAAGCTGGAGCACGCGTACCGAAAGTCCTCCGACCGGCTGGAAGAGACCGTGAAGAAGGTACTGAAGAGAT
GTATAGAGTAGAATGAGGAGTTTTGCAATGGCTGACGACACGGGGTGGGTTGCGTGTCGGGTTGACTGTAGCTGCAAGAGAGCCTGTCGGGGTCCACAGA
AGCTAACTTATTCGAGTCCTTACGCCAAAAGGTAAGGGTCCTGAAAACGCGTTTGTGCAGTGTGCGTCGCACTGACATCGTGTTGTATATTCGTCTGTAG
CTTTTTCTGCCGACTCTATCGGCGATTATCATGGAAGGCTCCGAGGTGCCAGTTCTCAGTCTGATGTCTACAGCTATGGACGCAGCACGCATGATGTTGA
TACAGAAGACTAGTGCCGTGATGGTGTGCGATGAAGCAGATCGCACTGTTGGCATTTTTACTTCAAAGGATTTGATGCGGCGAGTGGTGGCACTATCGCT
GGAGCCTAACCAATGCTTGCTTTCTGGCGTGATGACGCCCGAGCCTCAGACAGCCACGCTGGGAACGACGATTTTGGAGACGCTTCACTCGATGCACAAC
GGAAAATTCCTGCATGTACCCGTGTTTGACAGCGATAAAAACCTGGTGGGTATTGTAGACGTGCTACAAGTTACCCACGGCGTCGTCCAACAAATGGGCA
CGTTTCAGAGCGTGAAAAGTGATGGAGTACAACCACTGTGGGATCAATTTCGCAATAGTTTGAAAAGTGCCAACGATGCCACAGAGCACGAAGAAGTTGA
CGACGACGGATCCAACGTTGGTGTTGACGATCCGGATGCGGATGATGTGGACATTGCGTCGCTAGTGGGGCGCCGAACGTGGAGCGATTTCCAGTCGTCA
ACTGGAACAAGTGTTACTGGTGACCCCGCGCTGCTGGATGAAAACCCATTAAACGAGCATGCACCCCTGACGTGTTTGTGTACAAGCTTGCCGACTGCTA
CGGCAACAACCATCGTTTCACAAGTTCTGCTGAGTCGGTGAAGCAATTGCTTGTGGATGTCCAGAACCGACTGGGTGACAACACTATCCGCCGAATCCTT
TACGTCGACGACGAAGGCGACCATGTACGTTGTGTTTTGCGTCGTCTTGACTCATCCCAAGTTTTGTTTAATCTGACGGTTCATTTGCTTAAATCGTAGG
TGTTACTGTCCGAGGATTCAGACTTGAAGGATGCCGTTAACCGAGCTCGCACATGGGGAAACAAATACATCCGACTTAAGATCCCTCACTATCGACTCGC
GGTGCGCCGTGCGTTGGGGCAAAACAGCGATACAGCGATCGGTATGGTCGTGTACGCCGCTGCTGTAGCTGCACTTGCGGGCGCATCGTTTTTCTTGAGT
AGGCGCAAGTGA