Transcript Name :
Phyke_g460
Orientation:
(+)
Number of Exons:
10
Description :
hypothetical protein PHYSODRAFT_445341
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Sugar/inositol transporter1.7PR00171
Sugar/inositol transporter1.7PR00171
Sugar/inositol transporter1.7PR00171
Profile scan predictionP-Valprediction_id
Major facilitator superfamily domain19.162PS50850
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Major facilitator superfamily domainIPR020846
*** None ***
InsideOutsideTMhelix
47-52
102-171
234-239
297-308
359-675
1-23
76-78
195-215
263-276
332-335
24-46
53-75
79-101
172-194
216-233
240-262
277-296
309-331
336-358
*** None ***
*** None ***
TypeScore
endoplasmic reticulum444
GO
Biological ProcessGO IDPrediction Method
membraneGO:0016020IEA
*** None ***
*** None ***
Sequence
        4646 bases(100 bases per row)
ATGGCTCAACATCGTGTGACCCCGCCGAATGCAGCTGATTATACTGTAGTTGGCGATCCACGAATAAATGCAAGGCCTTTTTGTGGAGTGCAAGGCTGGA
TCTGCGGTCTCAGCGCACTGTCAGGCTTCCTCTTTGGTTATGACCTGTGCGtcatggtggtggcgctACCACTTATTGAGCAGGTGACGGACATATTGCG
CAGACATCTCGAAACAACTTACGTTTTTGTGTGCTGATGGGTGGCGATATTTTACTATGATATGGTAGGACTTTGAGCTGTCGACGTCTTCGGCTGAGAG
TGTTGTGAGCACACTCATGCTTGGCGCAGTGATCGGGTCGCTGGTTGGTGGGTTCGTTTCGGATTGGTACGAGCTTCTGTTAAAAAATGCTGGTTAGAAA
CTCAAGAACTGATGGTATTTTGCGGCGTTGTCTCGGTAGGATTGGTCGTAAGCCTGCCAACTTGATCACTGCCGCGCTCTTCCTGGGTGGATCGTTGTTG
ATGACATTTGCAGGGTCGTTGCGCACAATGCTAGTCGGGCGCTTTATTGCTGGTCTGGCAGTTGGTAGCAGTGGGCCGTGTGTATCGACATATGTGGCTG
AAATTGCCCCGCCAAAGACTCGCGGAGCACTTGTAACGATCAATGAGGTGCGTGCAGTTTCACCGTGCATTAATGACGTCGAATGGATTATAGACAAACA
AAATCACGGTCTGATTTGACAAACTCAGGTCATGGTGTGCTTTGGCTGCCTCTTATCGGTTGTCGTGAGTGCTGGGCTACAAGATAGTGCGGTGGGGATG
ACATACCACATGCCTGCTTACCCTCTACGTTCAATCTGACTTGAAGTGCAACTCGTGTTTGGGATTGTGATTTCTGCTTGATAGAACGGTTGGCGAAAGA
TGCTCGGCATGACGCTATTTCCTCCGATTGTCCAATTGGTGCTGAATCGTTGTTCATTTACAAGTAGCACAGGCATTTTGTTCGATACCTAATTTGGCTT
GGCTTGGTTTTGTTTGAAATTCTCTGCAGGTTGGAATGCCATTCCTACCTGAATCGCCTCGTTGGCTGATATCGGTGAGATTTAGTTGTCAAACCACTTC
GAATTTCAAAAACGCACCTGTATTAACATGTAAATCCACGATTTTTATTGTAGAAGTATCGGACGAAGGAAGCAAGTGCCGTACTAAAGCGGTTGCTTTA
CACTGAAGATGCATCGCAAAAAATCATCCAGTCACACCTTGATACGGGGGTACGCTTGGTTGTGCAGTTTTGGATTATACTTTGCTAGATCCCTGGCTAA
CTGTGCTCTGCCTTACAGAGATTTCATAATGGCTTTTTCCACGCATTGAGTGAGCTGGTGACAGACGAAGTGACTCGAAAGTGCGTGACCTCAGTATTTG
CAGCGGGCACCATTATGCTGTATTAATTGTTGGACCTTGATCATTTAGGCGCGTCGTGTTTTGTGTAGCTATCGCGTTTTGCCACATCTTGACGGGGGCA
AATGCAATGCTGTACTACTCAAGCTACATTCTGCGCAAGTTGCACAATGGAGACCACTTGCTAGTCTCTCACCTCAGCAAAGAAGTATGGGTGGGCGTCG
CTAAACTTGCTGGTGTATGTTTGGCCGTCGTGATCGTGGATCGTGTTGGCCGTCGCCCACTACTGCTCATCGGTACCAGTCTGATGCTGAGCTGCCACTT
CATTTTCGCGCTTTGCTTTTGGACCCTCAATATGACGCACTCTGAGACCGTGCAGGCAATTGGCGAGTTGAATCTCTATGCATTTATCTTCGCGTGGAAT
CTGAGCTGGGCACCGTTGATGTGGGTCACGTGCTCAGAGCTTCTCCCGGATGAATTCCGCTCCATCGGGATGGGAGTCACTTTCGGCACGTTTTGGCTTG
GAAGTGCGTTGGTGAATCAAACACTCCTCTCGGTCTTTCATACTATCGGAACTGGTAATGCTTTCCTATTCTACACTACGCTCACCGCTGGCTCACTTGG
CTTTGTCTACTTTAAGGTTCGTATGTATGGTACTCGACTACCCTCTGTCTGGTGTACAAATTAATTGTTATGCCTCATTCATTTTAATGGACAGGTGCCG
GAGACCATGGGACTCACGTTCGAACAGATCGGATTACTTTTTAGCGAGCACGTTGCCCATACACACAACGTGGTATGACGATAataacaataacaacaag
ATAAGAGACGGGCAACCCGCAGTGTATCCCGGGTCGGTATCCCGAAAGTCGAACACACGGCAGTCTATTCATCTGAAGCCCCATAATGGGGTTTAGCAAT
AACCGTGGCGACATATTTCGTCCGTTGCTCTAAATGCTTGATCACGTGAATAGCTGCCTTACTGTTTCGTCCTTTGCCATTGTTTTCCTAAGAACGAACA
ACACGGATCTAAGACCATCACACGTGAGATCTGTATGCTTACTACTTATTTGAGGCGAGTCAATGCTGGCGTATGAGGCCACCTAGTGCACACTCATTGA
CCATTATCTTGTGGCTGTGGTCGTTGCTGAGAGTTTGTTAACTTCACCGTCACAACGATACAGTTGCCACAATGGGACGGAAGTGTGTGATTCACGTGAA
AGACATTAACGAGGTGAGCACGAAGTTGAAAACGATATCGAACGACCCACCTGCCAATGCACCATTCATCgaccaagacggagacaCTTCTTGGGGTCCG
GTTATCTTGTGTGACGTGGGAAGACTTTGAACGATGGATCGATAACAACTTCGGACGGGTGCGACGGTGGTGCTTCGAGCCTTCCGATGATGGTACAGGC
ATGGGGAGAATGGTCATCTACAGCCTTCCGTCAGGCGTTCACGAAAGAACAGCAAACACGATTGAGCAGTTAATCATCTCACAAATCCTACGGGCAGGGA
ATACCATCGGCACTGTGATTCCTAGAAGACTCATTTGTGTCATCAGAGATTATGGTCAACAACCTAATCGGAGCTTGACGCCTGTGGACCTCACTGTCGG
AGGAGAGGTATTGGCGGCTGAAGGCGGCTTCCCATTTACAAATGTCGTCATTAAAGCTGCTTACAGGAACGACGAGTTGATGAGACTTCGTGCTAAACTT
GAGCGCTGGATGGATCCAAGGTGGACATCTGTGCAAGTGACGATCGGAATCAAGATATTTGCTGATGGAACTACTCCGCTGCGTCGAGTTGCCATTTTAC
ACCAACGTGGTCAGTCCATTCAAGAAGTGGAGTTTGGACTGAATTGTCGGCATCTACCTGCGTTGGTGTTGACATTCCCACTTACAACAGTTTACTTTGG
CGTTGCTCTACCAACAGCTTTGTCTGGTCTCGACAACCCTCAAGTCTCTATTGACCTGTTTGTCTTGCGAGCAATGTTTGAGACCTACGTTGGAAGAGAG
GTTGGTGCTCAGCGGGCAGATGAATAGTCTGCAATCCCAGCTTCGATTGCGTAGATATCGGTTTGATCTCCTTGCTTTCGTGGCCAATAAGACCGTTAAC
AATCGAGTCACCTTAGTTGTTACAAGGACTGCCTTGCAATTTGCTATTCAAACCGTACACACGTCACATGGGACACTGCATTTTAGATTCGGGATAGGCT
CAGTTATCGATTTGCGAGGACATCATGGACGGGCTGGACAATGACGTCCTATCATcgactcagcagcagctggaggagctcgagTGTATGCTCAGTATGT
TCCCAGATGCCCAAGAACTACGCGTTGACTCAGATGCAAAGCAACAGCTTGAGGAATTTGCCACCCAAAGCCACGGACCACGTCCTGATCGTCGAATCCA
GTACACGCTTTCCTACAAGGTTGTAGCAATTGCATAAAATAATTGATTCAAATGGTGTCGACACTAACAATCGCTGTCTGTATGCTTGTTGCAATGCAGG
ATTTAGCCTTTGGACGACAGGTGCCGGTCTTAACTCTCACGTGTCCACTGGGATACCCCGAAGTCGAACCGATGACATTCGAGGTGCAATGTCCACAGCT
TTCTCGGATAGAAATGGAAAAATTGCAAACCGAGTTGTTGGAGTTGACAACAActgcttgtgcagctcatGAGGTGGTGGGGTTGCAGCTTTATCAGCAA
ATGCACGAGTTCCTGTCACAGGTGCAGAGTAACAGAAGCATCAATGAAGGTCAAAACGAAGACACTGCTGTTGAGGTTGCGCCGACAAAAGTAGTGCTGG
GTCGACGTGCTATCTACTTCCACCACATCATTGCATCAAACAAACGTCGTGTGGTGAAGGAATGGGCATTAGAGCTACAACTCGGCGGGTTTAGTAAGAT
CGGTTGGCCAGGTGTCGTGATTGTCGAAGGAGCAGAAGCCAATGTGCAGGAGTACGTGCGTCGACTACAGCACCTGCGCTGGAAACAGATTACTGTACGT
GGAGAGCAGACAGAGTCAGAGCATTGTTCCTCAGAGGGGTTGGACACAATGAGGAGGTTACCGTGCAACTTTCACGAGTTCCCAGAGAACGGCATGTCTG
AGCTCGCGGCTGCTTGTCGGGTTGCTGGCCTAGAGGACCTTTTTCTCACTACCATGAAAATCTACGGTCGATCAGAAGACAAGGAAAGCGACAAAAACTC
TACACAGGGCAGAAACCAAAAGAAGGGAAGCCGAACACTGGGATAG