Transcript Name :
Phyci_221529
Orientation:
(+)
Number of Exons:
7
Description :
mitochondrial Rho GTPase putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Small GTPase superfamily1.8PR00449
Small GTPase superfamily1.8PR00449
Small GTPase superfamily1.8PR00449
Profile scan predictionP-Valprediction_id
MIRO9.93PS51423
EF-hand domain7.484PS50222
EF-hand domain9.52PS50222
HmmSmart predictionP-Valprediction_id
Small GTPase superfamily, Ras type3.1SM00173
Small GTPase superfamily, Rab type9.4SM00175
Small GTPase superfamily, Rho type5.7SM00174
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-636
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
GTP bindingGO:0005525IEA
calcium ion bindingGO:0005509IEA
GTPase activityGO:0003924IEA
intracellularGO:0005622IEA
membraneGO:0016020IEA
protein transportGO:0015031IEA
signal transductionGO:0007165IEA
small GTPase mediated signal transductionGO:0007264IEA
*** None ***
*** None ***
Sequence
        2385 bases(100 bases per row)
ATGGCGGCCACGGCCGCGTCCAAGCCCGCGCGCGGCGACGAGGCCGCGGAGCCCGCGCGCGCCAAACTGCCGCTCAAGCCGCAGGTGGTGCGCATCGAGG
TGCTGGGCGACGAGAAGGTGGGCAAGACGTCGCTCATCTGCTCGCTCGTGTCGCGCCACTTCAGCGAGAAGGTGCCCAGCGTGCTGCTGAACGTGCAGAT
CCCGGCCGAGGAGAGCGACGAGAACGTCATCATCTCCATCACCGACACCTCCTGTGCGTCAGACTTTATTCTTGTCTATTTCAATAATTTTTATAAGTTT
ATGCAGAGAGATTGTTTTTTTATTATCTCTCGCTGTCTGCAGCCCGCGTGTCCGACTTGATGCGCGTGACGAACGCCGCCAAGCGCAGCGACGCCATCCT
GCTGGTGTATGACCTCACGAGGCCCGAGACCTTCCAGCGGCTGCGGCGCTGGCTGGACTTCATCGCCAAGAACAAGGAGATCCCCGTCGTGCTAGTCGCC
AACAAGGTGGACATCAACGCCGTCACCCCCACGACGGACGGCCCCTACGCGAGCCAAGTGCGACACCTCGTCAACACGTATCCGGTGGGTGCATTAAGTA
GTATTATTGTGGGGTTTTGCAGACAGAAATTTTTGACGGTGCGGTTGTGCAGTTTGTGGTGTCGGAGGTGGAATGCTCGGCGAAGAATTTCACGCAGGTG
GCGCAGGCTTTCTTCTTGGCGCAGAAAGCAGTGCTCTATCCCGTGGCACCGCTTTACAACGAGAAGAAACGGGTGCGTTGCGGTTATGGTGATGATGTTG
AAGCAGTTTTGAATTGAAACGAAATGACGGGTGTATGTGTGTGGCATGCGATAGCAATTGCAACCGAAGTGTCTAAAGGCGATAAAGCGCACGTTTCGCT
TGTATAATCGCGATCGCAGCGGGATTCTCAGTCGCGATGAGTTGAATGAGTACCAGTACGACTGCTTCGGCGTTCGCCTTCTGTCCACGGAGATCGATAC
GTTGATGGAGTACCTTTCGTCGGAGGTGCCGTCTGGAGTGGCTCCTGATCGCAGTGGACTTTTTGTAGATGGATTCATCTATCTGTGGTGGCTATTTATC
GATCGCAACCGGCCCGAGTCAGGCTGGCAAGTGTTGCGAAGTCTCGGATACAACAACGACCTGCACTTGGAGATTCCACCGGAGCGCCTTCAGCTGCCCC
CGTATGAAGAAGATCAGTCCGCGCAGCTTACCCCTCAAACGGTCGAGTTTCTGACGAACTTGTTTCGCCAGTTTGATGCGAACAAGGATAACAATATTGC
GGAGAACGAAGTTGAGGCCATCTTTTCCATTTGTGAGGACGAGAGTGCGCCGTGGACAACGTGCTCTGCGATCTCGTCACCGCTTCTGTATGAGAGAACC
ATGGTGGATGGCAAGCCTACGCTGTCGCTCGCTGTGTGGCTTGCTTGCTGGAGTTTTGTGGCTCAGGAAAACCCACAGAAGCTTCTTGAAACGCTTTTTT
ACTTGGGCTACAACGACAAGCTTTTCCCGGCCATCGAGTTTGTCAAGTAAGTGTCGTGCTCTGGCCTGAAAATTCTGATATCTTACTAAATCTGGCTCGT
TTTCTGGGTTGTAACAGGAGCCGCAGCCTGACGCGCAAGGCCATGAGGATCGACCGTAACGTGATCTCGTGCTACATTTTTGGTTCACCCGATTCCGGAA
AGGAGCACTTTCTTCATACGTTTGTTGGAGATAAGGAGGCGCCCTTAACAGACGATGAGCAGTTCATTCTGCGCGGAATCGGCGCTGTGCCTGACAGGGA
CACGACAAAATACCTCTTTGTAAGTGAGATGCTTGTTTCTTTGATGCAGTAGCCATTGTATTAATGGTTACGCTTGCTTGTCTGCACTGAGTAGATCACG
GATGCGTTGTCGGATGACGAGATCGAGATGAAAGCGGATGTTCTGCTCCTGGTGCTTAATCCTGAGGACGAGCCGAGCAAGGTTTTTGTGGAGGAGCTCG
ATAAGAAGCTGCCCGTCTCGATTCCTCGCGTGGTGATTAGTTATAAGCAGGAGAAACAAGATGACGACGTTGAAGAGGGCAAGGTCGATGAGAGCAGTGC
GTTGGTGAAAGAAGAACCCATCGACTTTGCGATCGATGCGACGCTGAAGCAGTACCCGACAGCACTCAAGTGCTACGAAGCACACTCTGTCAAGGATGAG
GTCGCTCGTGTTCTTGTGGCCACTGCCTTGAGACCGTACGTGGCTGTTGGCTTTTTAGTGCGCTGCGCCGCAGAGATGTCTCATTAACCCGTATCCTTTG
TGTATATGCTGGAGCAGCCCCAAGAACGCGCGCTCTAAATCTTCGGGCATCTGGCTGCCAGGTCGGAAGACGGGCATGGGCGTGA