Transcript Name :
Phyci_221264
Orientation:
(+)
Number of Exons:
1
Description :
PREDICTED: dysferlin-interacting protein 1-like
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain20.473PS50297
Ankyrin repeat15.574PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat1.1SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-76
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        231 bases(100 bases per row)
TTGTTTGACCACGGCGCGAAAGTGAACACGCGTGACGTTGGAGGCAACACCCCGTTGCACTTGGCTATCAGCGAGGGATACGAGGATATCGCGCGATTCT
TGTTGGAGAATGGGGCAAACCCGAATGCGAAGAACAACGATGAGGAGCGCTGCGTGGATTTGGCGAAGCCTGCATTTCGTGCAGAAATCCAAATGCTGAT
GTCCAAGAAGAAGGGTGGCAATCATCCTTGA