Transcript Name :
Phyke_g163
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein PHYSODRAFT_469105
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-29
103-121
214-219
262-342
53-84
145-195
238-241
30-52
85-102
122-144
196-213
220-237
242-261
NN-scoreoddsWeighted Score
0.5151.1610.002
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        1195 bases(100 bases per row)
ATGGGGAGAACCTGGAAACTGCGTGACAAGGAAAACTTCATGAACTATATGAAGATCGAGATTCAGCTCCTTCTGAAGGAGTGGAAGATTATCTTGCCGT
GTGTCATCATGCAGTGTACGTTGTCTTCTGTCAACGTCCTAATCGTGTGGCGGACGCAGTGTATTGACAGTTTTGGGTCCATTTCGGTGTTCAGACGTCC
ACGCAATTTTCCACAACCTGGCCTACTACATCCAGGGCAACTACCTTTCGACGGAGCAGCGCTTCACGCTCTACGATCTGGGCTATGAGCTTATGCCGGA
GCTGACGTACGTTCCATGACTATGTGGATTAACGGCACAAGACAGTCTCGATTCTGACTATGTTGTTGTATTTAAAAATGCTCGTACTTACAGTGGCTTC
GCGGCCGATCTCTCGGACATTCTGGTGTTCGTTGCTATCTTCGGTCCAGCCATCCTCCTGGTGCTCACGATCCCAGCGTTCCGCCAAGACCCGAAGCGCC
CGCGCTACCTGGTGATTGTCCTGAAGCGATGCCTACTGCAGTTGAGCATCTGCTTGGTCCTCCGCTGCATCTCGTTCTTGGTGACTGCTCTCCCTTCCCC
AGCTGCCCACTGCGAGCTGAAATTTAACGACACGTGCTTGGAAGCCAATCCCAATGATCCCGTTCCGTGCGTTGTGCCGAACCCGGAATTTAACCCGCCA
ACTGTTAGCGAATGGTTCACACGATTGGATTCGCTGAATGGCTGCGGTGACTTGATGTTTAGCTCCCACACGATCTACACGGTGTCGCTTATCCTGACGG
TCTGGAAGTACTGGCCCAACAAGTTCGGAATCACGATCATGGTGTGTGTGCAGATTGCGATTGCATTTCTCATTGTGGCCTCGCGCAAACACTACACGCT
GGACGTGTTCTCTGCGCTCTACATCGTGCCGCTCTTTTGGGTCACGCTGGAGGCTTACCACAAGGACATTAACCACAAGGACTCGGAGGTTACTGTCAAG
ACGATCTACGATTACTACGGCGTTGATGTCTCTAGCGATGTGAATAGCGGCTCTATTCCGCTTGACTCCGTTGAGGTCACCCCGGCTGCTCCGCCCAGCT
CAATTCAGGTTGGGATGACGGAGGATGAAAGTCTCAGTGGGGAGAGCACCCTAGACAACACTACCACCGCCTTCCAGCGCAAGAACTCAGTGTAA