Transcript Name :
Phyke_g136
Orientation:
(+)
Number of Exons:
18
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain29.202PS50297
Ankyrin repeat12.583PS50088
Ankyrin repeat10.392PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat2700SM00248
Ankyrin repeat260SM00248
Ankyrin repeat3.7SM00248
Ankyrin repeat0.42SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1139-1149
1202-1213
1282-1301
1343-1354
1-1115
1170-1178
1237-1258
1322-1324
1378-1880
1116-1138
1150-1169
1179-1201
1214-1236
1259-1281
1302-1321
1325-1342
1355-1377
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        8885 bases(100 bases per row)
ATGAACAAGCTGCGCACAATATTAACGCACGAAGACACAGGAGTGCGATGTAGCGCTATTGAAacgctgtcgaagctgacAGTCGACGTGGTCATCAACG
TCGCAGGTGACGGGCTTTTTGTCTTCCCGTTCGAGTCACACGAGGCGCGAATTTGCTGCCAACAAGACGTGGAAACGATGGTAAATGACTGCTGGAAACT
TATTTTCCACACACTCTTCCTTGACGGTCAACCACAGAACGCCGATTGGGTTGTGGGGGCTGCGTTCACAGCCTTAGCAAACCTGTTTGCACGATCTAGT
TCAATGGCACTATTTTTCCCAAGTATCCGAGAGGCTATCCGTGCCCAAGCGGCTGTGGACGACGTGACCTCAATGGTGTACAAGCACGCGTTCCCGCGTA
TTCGCTCACTGATCACTGCAGCGCAAACACTACCCATGAAACAGCAACCAGATGCAATATTATGGATCGGCATGCTGCTTCACATGATGATGGAGCGCAG
TGGTGCGCGATGTCCCAGTGTCAGCGTGCCGTATGTTGAGATTGACGTGATTGACGAGAATAACCccgatggagcagatgatgacgacgatgaagaggct
CAATCCTCTACAGAGCCCGTTCGAGTTGATGAACTTGTGAGTGACCTGCTTGAGTCTTGGATCATGCCTGCAATATCGCGGCGAGTATCACTTGCGCAAG
CCACCAGTATGTGCCGTGCCATCTTTATTTTGTTGGCACATCCTCTACAATCATTCACTCGGATGCGGTGGGCTGCGCAGCTCGCTAACCACCTTATCGC
GCAATGCTACCTTGTTAACAAGAATCCTGGTAACTGCAATGCCGGACAATACGAGTTCAAACTCGAATTTTCCGTGATGCTTGTGAAGACGTTTGCGTGG
TTGTCTGGGGTCAACTGTCAAGCGCTCTTCGTTAGGACAACCGAAGCACTCTATCTTCTCGACCAAGAAAGGGATCGTCGAGATATTGTGCAAACTCTCA
TGGACACGATCATCGCGCACGTTGTGGCCAATCGGGActtccagcttctccaggGACTATGCACGCTAACATTTTTCAGACAACCAAAGGGATTCTCCAG
ATTATCGCCACGCACTAATGGCTCCGAGGTGGCTCGCGCACTGTTTCAAGCTCTTAGCTCCACGTCTACATTTCCTTCACCTCCGCAACGCGGGGCTCTC
GAGCGACAAGTGGCGCAGCTTATCGCATTAAGAGTGTTCCGTGGTTTACTGCTCTTGGAGTTGAGTGGCTCAGCTGCGACCTCGCCCAAGGCATATCGCC
GATCATGTGAGATCAGCGAGAATGTCGTTTACTACACAGGAGTTTTGACGACGCATTTTCAAGGCATATTTGACAGCCCTGAGCTTGCACTTCGAGAATC
GCTCGATTTTTTTCAGAGTGAGCTTTTTCCAACTATGCCCCAGGTTGCATCTCAAAGTGCCCGACTTCAGATACTCTGGATTGGTGTGCGTCTTCACCGC
AATTACGCACCGCATGTACCATTTGAAGCTTTAGTGAAGGAATTGCAGCATGAGACTGGTCGACTTTTCACCGCTATCTGgaacgatgatgacgagatGG
AAGGCGCGACTTTCGATAACGGTTTGCTCGgttgcggtggtgctggagtaGAGGAGATGCCTGCGGCCCGTAAACGCGCAGGGGATGCCAACACGGTTGA
CGCATTAATGGTGCTTGGTGACTGTattgctcttcttgcccaaCTTCAGCCTTACACGCAGCCCCAGTTTTTGAAAATGTGCGAGCAAATGATAGCGGCA
CTAACAGCATCGGGAGGCCCTCCAGCGACCACGTCTCAACAGTATCGCATGTACGCCAAGTTCTTAGCGCCTTGCCCCAGACTACTCGTGTCTTATGACT
GACCTACTTTTTCTCATGTATTGAACAGCATTGAGGAGGTAGTAGCACTTCTTTCAGCATCCCCAGCGACGGATTCACAATCAGCACCAAAACCTCTTTA
CTCAAAAGAAATTTTTGATCCACAAGATATATTTCTGCCAAGAAAACACCACAGTGATGTTGATTGCTTAGAAAAGCCCCAAGATGAAAGCTACCCGGAG
CCGACTATCGTCACGGGTAGTGCTGACCCAGTCTCTGTCCGCGTCTCTCACTACCACCCGATGATTGGCAAGGAAGAAGTTGTTTCCCTCGAGGTTAGCT
GTTGTAATCTCACTACCTGGTCGCTAACCGACCTGGAGATCCAATTACGTCCGCTTGGAGGCGTGGGTGTTGTTCAGTGTGTCGATTCCTCCAAGGATTT
GAAATTGCGATTACTTCGAGCCGGGGAGACTGTCAGTGTTGGTATaagcggcggcagcagcagtttggcTCCATTTGGAGCAATCAAGGCGGAGAAACGT
TTCCGCGTATGCCGGTTCACACAAGCTACCTTTATAGTTCAAGCAGTCTTTGTTCATGAAAACCAAGGTGACGGTGGCGAAGCTGCCGAAGTTGAATCTG
CCACACCAATTCGGCTGGCTTTCAGTGACCGCTATGTGCTACACTTCGACACACTACTACGACTACCGCAGCCTCAATTttcaactgctgctttctttca
gcactgctggcaaACGTACGatctttattttttgttATGATTTGGCGAAAATTGGTAGCATGCAACTAATTTGTTGTGTTCTGCTTTAGTGCCAATTCGA
GTGTTTTGTGGCACGTCAACTCACGGAGCGAGTTCGATTCTAGTGGCGAGCAGCTAACAGCATGTCAGCGTGTGCTTCACGACATGAACGACATAATTAC
AGCTGTTCCTGATCTGCTCCTTGAGCTGCCGACGCACATGCATGTACGTTGTCATCGATTTCTCTGCTTCTGTTCCGTTATACTTACTTGCTTGCCAATG
CCGTGTAGGTTGCTATGCTGACTCAGACGCGATGGGGGTACTATGTGTCCGCTTCACTCACAATGAGCGTCGACTCCGATACCCCAACTGCGGCGAACTG
GTCCGGTATCCTGGAAGTCCGCTCAACTCGTGAAAATATCCGCGAATTTGAGCGATGGCCGAAGGATACTGCTCGCATCTTCGTCGGGGACCACGTGCGG
ATCTGCAGCGCGCCGGTGTTGGTATCAGGAGCGCGCGACTCAGTGGGGCCAATCAGTGACGCTATCCCGTCCTCCAtgctgtcatcttcaaccCACAACT
CTTTTACAGAATCGATCCCAGCTCCAATGCTTCCGATCGCAGTCGGAGACAGAGTGGCAAGTGGGAAATCATTCCCTCAGCAAGTGCCAAATCCAAACTT
CGCATCGGAATTCAGATCAACTGGAAGCTTTGATCCAAAGACCACCACGATTGACCGAATGCCATCATTTACACGAACACAACCTCCCGAACAAGTTCGA
GCACCGGAGACCATCACTTCACCCAACGAACCATGGGGGACATTCCTCTAATAATGACACAGTACGTTGAAGTTTACCTCAACATCCACATCTTGAATTT
TATTCAACCAATCAGCTCTCGTGTCCCTTCAAATACACTTTTCCTATTGGTCAAAACTCCTTTTTTCTGAGTTAGTTAGATCCACTTTTTGAGCAGCTCA
CGAGAATGCCTCGTTCCGACGGCCGTGACAGGCGCCGCGGAGCTTCCTTACCTCCTCTAGGCGACGAAGAGACGGAGGAGGACCGTATATACCGCCCACT
ACTCTTCCAGTCCACTGGATATGCGTCTTCGGAGCTGTTCCGCGACTCGTACGAGATGCACTCGCGTCTGCCGGTAACGTCCGCCACGGCGCCACTTCTA
GGGGTTGAAACAGGGTCCAGAGGGTTCATTGAGAGCCCAAAGAAACGACATGTGTTTGAACCTCAGATCCGCTTAGAAACACTGTCTTCACGGGCTGCTA
CAGCGGTGTTATGGGTCACTTATGTGGCCTTCTTGGTGGCATTGACATTGCCGTATTTACAAAGCAAAGGATATTTAGAAACAGTAGGGCAAATGGAGTT
TTTAAGGGTGATCAGTGCAATATTTGATTGTTAATATGCTTTTTACTGTTGTTCTATTTTGTAGGCGGTGGAACTTCCAGGAGGTCTTTGTAAAAAGGAG
GACAGAGTGAGAAGAGAGCCGTGCATTGACGTGGACAAGACTAGGGATATTGCACAGTGGACAGCATATATCAGTAATGTGTCGCGGTATGCTGGGTCTA
TTGAAATCAAGCTTGACGTTCGAGAACAAGTGAACACTTCCAGTTCTGCGGAGCTGATGTCGAATATGGTAGAGAGCAACAcgttgcaggagctggaacg
TGTGGGAGCAGCTTGGACGATGGATAGAGACGCAAACAGGGTGAAACGCACAGCTAAACAGGAGGCCTCGAGTGTTTCAGAGATTGAGAGCGGAGAAATT
GAGGAAGTGGGTTTTGTTTTGCGCTATGATGCCAGACTTTATGGCATTGACCATGATGTGACTCCTGTCTCGAAAGATCTCGTCGCTGATGAGCAAAATC
AAAGCGTTTGGATTGAATGCCGCAAAAGTGGACCTTGCGACCTTGTGCGCCTTGTGGAGATAACACAAGACATCGATCGGCTGGTACGAATAGATAGAAA
TCTGCTGCCACTGGGTGGTGTATTTCGTGATTCACCAACTTGAGCCAGAGTTTTGATAAATGGGTGTGTTTTTCGCGTAGGGCGGCAGCGGATACGATGC
ATACTTGGCCACTTTAACCTTTAGAGGACTGTATCCGAACGTTTTTGGCAAGGATGTGGTGTATCAATTCGCGTACACGTATGTATATTCTATGGCTTCA
TTGACAAAAATTACGTGGAAGTGGGTTACTGATTAGTTGTGTTCTTCGATATATTTTACTGCAGAAAACCAGCTATTCACGTTGGTGAAGTCGTTGTGCG
CACAGCGTTGGTTCTTGCCTCCATTTTAGCGCTCCCGTGCTGGCTTATTTCGATACTAAACTTTCACGGAGGCTCGTGGAGCCAAGTACTCACCGTACAA
AAATGGTTGCTGGGCTTGGGTGTTGTACTGGTTCTCTGGCAGAACCCGGTGTACGCAATATCTGAGTTATACACAAATGTGAGTATGCGCACGCGGTTCG
TGTCAATCACGTGCGAATCCCTTGCAGAGGCCTTCTTCTACGTGTTTTGGTTGAACCTTATGGATCAGCACAGCAGGGATTTCTCGTCGCGGAGATGCGC
ATTTTCCTCGAAGCTGGTGTTTGGTTTGGCTCTTTTCGGGGTGGACTTGGCTATGATCGTGCTACGGATGCCGAAGTTATTTTTCGGAGCAGAGGTAGTG
CCGTCTTCCCACGAATTTCACCCCGAAGAGCTCTATGTGCTGCTGGGATTCATCCGCACTGGTCTGGTGCTTGCTTGGCTCGGGTGGATCATGGCGGTCG
GGGCACGATCGGGGCGGCACCTGAAGGAACTGCCTTATATGGCCACTCGCTTTAAGCAGCTGTCGTATAGATTCctcgtgctgcagacactgctcATTCT
CGTCTACGTGTTCGTGCTGTCCGCCTTGCAGATTTTCTATCTGGTCGAAACGTGGTACTTCGTCGGGTACAATGCCTTCATCCAAGATGCAGTGCACACG
TTTGCCAAGCTACACGCAGGTCACTCGTCACTGGGCAAATTTTTGTTTCTTTCGGTATACGTCTACCTGGTGATGTTTGTGCACATGCCTCCGCTTGCAG
GTAATAGCACCGGACTTCTGACGTCCACAGCCTTCCACGTGGACGAGAAACCACGTGTGGACTCGTACGGCTTCCTCACATCCGACTCAAACTTATTCTG
CGTGGAGACGGCTGGATGGCTTCTGGAGATGGCATACCAGGCTTATTTCGATCCTCCAGGGCGTCCATCTCCGTCTGGATATGGCGAGCTTAACCTTGAG
CAGCACGGATTCGAGTTAATTACGCACCTCCGGAGCAGTTTGACCGACACGCACGTAGTCGTTGCATGGAGTCAAGCGGACCATCGGCGATTGGTCATTT
CCTTCCGAGGCACAACAAGCAAAGAGAACTGGAAAAGTAATATCCGAGCTGACCAGTACGTGCTATGGATTAAATCCCGAGGGCTCCGTTGGAGAAAAAC
GTGTCTCGAAAGAGTGAAGGACTTTGCAGCGAAGATACCATTGATCAACATGGCGCTGCCAAGAGTTCATAGAGGTAACTAGCTTCTATTCGACATTTGC
ACCTGGAGACTCGTCTAATGCTGTGTTCCAATGTCATTCAGGCTTTTGGCTTGCGTACGAGTCGATTCGGGAAGAGCTAAAGGTAGTGACACGGCTCATC
CTAGACGAAAACCCGGGCGTGTCTGTATACATTACGGGCCACAGCATGGGCGGTTCCCTGGCGATCTTGGCTGCCTACGATCTTGCGGTGAATTTCAGTA
TCAAGGTCAACATGTACAACTTTGGTGGGCCTCGGGTTGGTAATCCGAGTTTTCGCCAACACTATGATCGTTGTGTCCCCACGAGCTATCGTGTTGTCAT
GGACGGAGACATTGTGCCGGGTGTTCCAAAATTCGTACGTGTACTTGcaattgttgttgttgatgttgtgTTTATTGGAATGCTAACAGCATTTTTGTGC
AGTGGGGGTTATATCAACACGTAGGAACTGAAATCTCTCTCGACGTGGCGGGTAACCTGATTGTTGACCCGAGTTTCGTTGAGCGCCATCTCCACAATTC
ATCGCGCCGTAAGTCGACAATGCATGGCACCAACGTCTACCGCGTGTCAATCGCCAAGTGTCTTGAGAATTTGACGGATTCGTAGCAAGCCTCCATGTTT
GACATGACGAACTTGGGTGCGTTATTCACCACTAATATATCTATCGAGCGAACAAACGCAGATGAAATGCAGCAAACACTTCTCGAAAGTGAAGCGTCGC
AATCCGTTTCACGAGGCGAGAAGCACTCTCAAAGTTCATTTGCTGTGTGAATCGTGACAGGAACTTGTTTCAGCGCCATGGATTACGACGACCAGCAAGC
GCAGGAAGGAGTTATTCGCTCGCATGTAGAACTCGCGGAGGCGGCGGCTAATGGCTCTCGCGCGATGGTAAGTGCTTAGGCATACGAGTGCTTCACATTG
TCAGCGTGACGGATTAACAAATGCCCTTGAACAATGGTCTGTTAGGTGGAGTTTTTGTTGGACAATGGCGTGCACATTGACTCGCCTGGAAAAGGTTGGT
TTGCTTTGCACTTGTTGAACATAGTGAGTGTTGGAACAACCGAAAAGGAGCTGATACAGTCTGCTTTGTGTTTTTTGTTTGCCCTACAGATGGAACAACG
CCATTGTGTGCCGCAGCTCTTTGGGGAAACAATACCATGGTCTCATATTTACTGGACAAGGGTGCAGATGTAGCTGCCAGAAACGAAGGTATTAAACCAT
CTCGTCAAACAATCTCATGATGTTGGACAGTGTCAACGCAGTGAGAATGCATACATCTAACACCAATTGTGTTGGCGACAGGCACGGGGTGGACAGCTCT
GCATGCGGCCACTTTTCAAGAACATGGTAAAGTTGTGCAGATCTTGCTAGGACACCAAGCTGACCCGAAAGTGGCCGACACGGAGGGACGTCGACCAGTG
GACTACGCCAGTATCTCCGAGGCCATTTGGCCCTTCTTCGCTGGTAAGCCAGGCTACAATCTTGTCGAAATACCTACTCCGACCtaacttgttgttttgt
tggtgctgctAACTTAGCTCAAGGCTACAGCAAAAGCCTAAAGTCGGATCTGATCATAAAAGGAATTATCCGCAAGATTCCGGACCAACCCGAGCAGACT
CAATCCGGCGACAAATATGCCGACAGTGTATGATGTCCCCTCTTTGCGTGGGTGGAGTATTACCAGTTGTTCCTGACCTCTTTGAATTGTGCTCGCTGTT
GTTTTATCTGCAGATTTCGTCATTCTCACGCCCTGGATCCTCTTATGTTCGAGCACAAATGGCCCCACCACTGGGTCGCCGACAGCCCTCCGCCCTCAAA
GTACGTCCTGGGGTAATTCTGTGAATTCAATAGCCGACTAACACTGTCGTGCATGTAGTCGCGTGACGGTCGAAATTTAACGGGACCCATCGACCCACTG
GGCGATATTCCAATTGAATCAAACCAGAGACGTCCATCGCTAAAGCGACTCGGTCTGTAGCCGTGTCACCTCCACCGTCATAGCGCTGCAACCAGCATAG
TGGTGCTATGCCAACATATCACAGCATAAGATCAAGAACTTCGTCCACTTGTTGCACTCGTTGAAGTGCGAACGCTAAAAAAAACGTGCGGTCCAGATTA
AGTCTCATCTATTACCGGTTTTGATATCTCtttacaaaaatcaagatTAAGTAAAAACCGGTTTCATTTGCAAAGAAACGTCAAGAGGGGGGCGCTTCTC
TTCCTGTGGTGCGTCGCTGGCCGCTCACTTCCTGTATCTCCTCGAGTCGAGCACAGCAAATTCGTTCGGAATGGTAAGGAGACCACCAGAACAAGACAAA
AAAACACTCAGATAACTAACTAAAGACTAACATCTTACGTCCTTATAATGACCAATGACAGTCGCTTCTTAACAAGGGATCTCGCGTCATGGCCCAGTCG
CTTCGCGCTGGTGCTCGCAACATGTCCAGCGCCTCCGAGCAGGAGGCCAAGGAGCAAATGCACCGATGGACTACCATCTCCAAGGGCATGATCGGCGTCG
TGGCGGTCTTCACGACCTACACTGCTGTGGACCACATGaaccacggccaccaccacgatgaGGTCCCGGACTATCCGTACCTCAAGATGCGCAACAAGCC
GTTCCCGTGGCCCGAATCGGACTGCGACTGGTTGGACCTGGACTGCCGCGAGAAGGTTCGTGCTGCCAAGAAGGGTCTGGAGTAA