Transcript Name :
Phyke_g176
Orientation:
(+)
Number of Exons:
4
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
MSP domain24.001PS50202
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
309-311
1-290
291-308
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
structural molecule activityGO:0005198IEA
KO ID
K06096
*** None ***
Sequence
        1173 bases(100 bases per row)
ATGGCGACGGGCGGCGTGGACGTGGCGCTCGCGCCCAACTCAAGTGTAATCCTAGAGCCTGCAGACTCCTTATCCTTCCACCTCCAGCCGCAGACCGCTC
CCCAGGCCGTGCTGACGATCCGCAACGTGGCGGACGACCGCCAGATCGCCTTCAAGGTCAAGACGACGCGGCCATTGCGCTATTTGGTGCGTCCCAACCA
AGGCTTGCTGGGACCCAATGGATCGGCTTCTATTATGGTCATCCTGCAGCAAAAAGActgcgacgagctgctgcgtctggacCCTGCCGAGCGTCAATTG
GCCAATGATAAGTTTCTGGTTCAAAGCATCTATGTGGACGACAGTTTCTATGAATTAGTCAAGACAAAAAGCACCAAGGAGATGGCAGATGAACTCACCA
ACATGTGGGCTAGGACCGACAAGCGGTCGTTAAGTAACAAGAAATTGCGTTGTCGTTTCGTGCaggatggagaagatggacGCCCTCCGTCGCCACCACA
AAGGGGGACAAGTACGTCCACGTCTGCTTCTTCCCCTGCCAAACCTGCAATGATACAAGAGACACGGTACCATACCAGACAAAGTGATGAAGCGAGGGAC
GACGTGACGACGCCCAGTCAATTGTCTTCGGCCTTGTTGCAGGATGACAAGCCACAGAAAGTGACGGAGGAACGGGAAGGACATACAGGAAAGGATGCGA
TCCAGGAAGTTGCAGCACTTCGGAAGAAATATGATGAGGTAGGTGGAGAGTGAGAGGATGATGTGATGAATTTTGCTGATGTTTTCtttgctgtggtggt
agTTGGTGGCATTCACAGTGCAGCTGACGGCTCAGCGTGACGTGCTCATGAGCGATCTTGATAAGACGCGACAGCTCTTGCAGAAGGCTAGTACCGACGC
TCAgcgtgtgaagaagctttcaGAGGAGTCGTCGACATTGCGTCATCGGAAAAATGGGGGtactactgctgctggtattgAAGACTCGCAGGCGATCACG
GGGAAGGGCCCCAAGGATCAAGGGGTACGTTTTTATTTGTTTATATGTTATGCTAGCAATGAGAATGACTGGCTGACTTGGTGATGTGTGTGTTGTACTT
GTGATAGGCTTTTGGTCCAATGCATTTGCTGATATGCGCGATtatcttcttcttggtggggCGCTACTACTAG