Transcript Name :
Phyke_g151
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_358780
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-226
NN-scoreoddsWeighted Score
0.7072.320.005
*** None ***
TypeScore
cytoplasmic435
GO
*** None ***
*** None ***
*** None ***
Sequence
        681 bases(100 bases per row)
ATGCAAGACCAGACTCGTAGTCTTCGAAAGGCCCTGGAACCTCATGCGGAGTTTGTGTTCCTAAACGGTCCCATTGAAGCTGATGGACCTTCAGACGAAG
TGATTGAGAAAATCTATGCAAACAACAAACCATTCTACGAGTGGGTCAGCTTCATCGAGCGCGAAAGGCCTCAGGACATTGACCCCAGCTCTGGAGAGAT
CGCGTACACTGACGGTGGTTGGTACCACGACTACAAGAACTTTGATACAATGGTCGAGTACATGGACAAGGAGCTCCCGAAGCTTGGGACAATTGACGCC
GTGGTGGGATTCTCACAGGGCGCGCAGATGATGACGGCGTTGTCCATGTGGTACCTGCAGAAGCACAATACGCgctggtggaagtgctgcgtaAGTGTCT
GCGGACCTCGTGTGCGTGGCGTCCCCCTTCGTCCGTTGTTCGAGAACCCGGACGGCACTCCTCGGTTGGTGCCGTTCCCGTCGATTCATATTGTCGGCAA
GACCGATATTTGGAAGCGAGGCTGTTACGAAATGGTGGACATGTACGAGGACCAACCTGAGGGTGCAGCTCGTGACAAATTTGTATTTGAACATGATACA
GGACACCGTTTCCCGTCGGGAGAACGGCACGAGAAGCTATACGAAGACGTCGCGCAGATTATCCGACAGCATTGCCAGTGA