Transcript Name :
Phyke_g164
Orientation:
(+)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat1PR01415
Ankyrin repeat1PR01415
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain39.47PS50297
Ankyrin repeat9.511PS50088
Ankyrin repeat10.793PS50088
Ankyrin repeat12.262PS50088
Ankyrin repeat11.808PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat540SM00248
Ankyrin repeat0.028SM00248
Ankyrin repeat7SM00248
Ankyrin repeat0.019SM00248
Ankyrin repeat0.0034SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-652
NN-scoreoddsWeighted Score
0.5431.1970.002
*** None ***
TypeScore
nuclear609
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1959 bases(100 bases per row)
ATGAAACGAGGTAATATTCAAGCCCCGGGAGACGATGGTGGGCAGGAAGAGCGAGGTGCGGATCTTAAACTCGCGCAGCGCCACCGGAAGATCGTCGCGG
GGGACTTCAAAGGTCACAAGACCTTGGAGCTCGAATTTGCCAATCCTGGAGTTGTGGGTAAGCTCGCATTGAGCTTCACTACTACTGGGCCATTAGCAAA
GCGCAGCCGCATTACGTGCCAGTTTCCAGATCATGGCTGGGTCTTACCCTCTGACGCGTTGAATGCCGTCCTACAGCTTCCGTCGCCGAATGAACACGCG
GTCAACTCGGCATTGCCCCAGGTGAAGGCACTTTGGACTGCGTCGACGCggatgctggagatgacgctgtTAAATGATAGTGTGATTCCGGCTGACACGC
CGCTAGTTCTGGTCGTGTCGGGTGTGTTCACACCCgagacagcaacaccgcAGGGTGAGATCATCGTCACTACGTTTGATAAGTTGGCGGTTCGCAGCAC
AGTACCGCAGTCTACACGCGGGGGGCAGATCATCGATGGCCCGACCGCATTCGCGATTCCAAAGATCGTACCAGGGTGCATTGAAGGAGCGAAGCGCTGG
TCCCCATTCAATTGTTGTCCTGGCGCTGTCTCAGACGTGACGCTGTCGTTTATTGTCTGTGGCAAGGTTCCAACTGGAGGGAAGCTGCTCGTAGAGCTGC
CTAGTGGATGGGATATGGATGAACAACCCAAGGTGTTACTTCGTACGCCGGTGTATCATAACAAACCTTTCACAGCAACCTGGGATCGAAAACAGCACAC
GCTGGAAGTTTGTCTCGGAAATGACAGCAAGTTCATTGCGACAAAGACGAAGGTCATTTTGACGATTCAGCGAGTTAAGAACCCCGACAAGGAAACGCTA
TTCTCAGCAGTAAGTGCAGTTAACGACACGTCTGCGGCAGCTAGACTCACAACACTATCCGCAAGTGGTGGTGTAATTGATGGCCCGAGCAAACTTGAAG
TGGCGCGCATCAGCGAGCTGCGTGAAAGCGATTTTGAGATTATCATTAAAGTACTTGACGCCGACGCTGCAGAAAATGGGAGTACCGATGGTGGGATACT
CATCGCCAGAGTCCCAGATCTCCTACGTCGAGCAGGCCTAACGCTTTCCGACGAACTATACCAATCGCTTGTGGTACCTTGCTTTCCTTCACGAGATACG
GTCCTAAATGATGAGCAAGAGAGCGATAGCTCTCCTCCCGACAGCGCTACAACCGCCGACGCTCCTCcagaaggcgaagaaacCAAGCTAAGTCCTGACC
ACCTTTCCAGagaggagctgctgaacgtGTTTGCAATTGTCTACGCACCAGCCTACAAATACGGACAGGACCTCCGTCTCGCGTGCGGCCGTGGCCATCT
AGAACTCGTGCGAGAATGGGTGAGCCGCGGTTGCAACCCGAATGCCGGAGACGGTTCCGGCTGGTCCGCGTTGCACTACGCCGCCGACTACGGTCAACTC
GAAGTGTTGAATCTACTTGTCGAGATGaccacaccaccaccggATGGAGATACCTCTGatagcagcaatgccaacaGAAGAGCGTTGGAAATCAACGCTC
GTGACGCTCACGGGTGGACGCCGCTCGTatgcgcagcagcaaatggtCACGTGGAGGTCCTGCAGAGACTGCTCGAACTCGATGCAAATATTTCCCTACT
AAGTATCGAGAACCGATCGGCTCTTCATTGGGCAGCGACTCGAGGTATGACTGCAGCAGTCACTGCTCTccttgcagcaggtgcagacGTGAACCAAGTG
GACCGCAGTGGCTGGGCACCTTTGCACTGTGCAATGCTACACGGCAACTCCGCCTGCGTTACAATTCTCACGGAGAAAGGAGCAAACGTCACAATGAAGG
ATAAACTGGACTATATGCCGGAATTCTACAGCGATGCCACCTTTTTCATTCCAGCTTAA