Transcript Name :
Phyke_g134
Orientation:
(+)
Number of Exons:
3
Description :
peptidyl-tRNA hydrolase, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-186
NN-scoreoddsWeighted Score
0.8043.3730.007
*** None ***
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        728 bases(100 bases per row)
ATGGAGGACATCGCATGGAAGTGCACGGCGGCGTTCCTGTTGGGGGCAGCTACGCACTATTTTATCTCGTCACAGCTGCGCAGTGACAGCATCCCTGCAA
CCTCCAAGACATCCAGCAACAATGACAGCGAGTCTcgctctgcagcttcctccagGTCGTCGTCGGGCTCCTCTGACGACTGGGAAGGCGCAGACGAACA
GAGCTGGAAACCCCACAAAATGGTCATGTGTGTGCGTACCGACCTAAAAATGGGCAAAGGTACCTACAATAATATTGCATTGGTAATGCGCTTTATTACC
GGTATTGGTGCTTACAACTATATTGCTAAATTATTGACAGGTAAAATCGCTGCGCAGTGCTGCCACGCAACGCTGGGAGCTTACAAACGTGCACTTAAGC
GTACTCCTGATGCTGTCCGAGCGTGGGAGATGCTGGGTCAAGCCAAGGTTTGTCTGAAAGTGGactcggaggaggagatgctcGCCCTTGCagagaaggc
tgctggcCATGGACTTGTCAACTATATTGTGGTATGTTGATTGACTGAGTGGCGACGGCTCTTGGTCTGTTGATGAGTGCTAAAACTGAACTGTGTTTTG
TATTTTTCTTTGTGCAGACTGATGCTGGGCGGACACAGATTGCGCCGGATAGCAAGACAGTATTGAGCATCGGCCCGGCCCCGTTGGCTGCTCTCGATGA
GATCACTGGCCACCTCAAACTCATGTGA