Transcript Name :
Phyke_g180
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_344165
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Glutamine amidotransferase21.432PS51273
*** None ***
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Glutamine amidotransferaseIPR017926
*** None ***
InsideOutsideTMhelix
1-580
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K01937
*** None ***
Sequence
        1743 bases(100 bases per row)
ATGAAGTACCTGGCAGTGACCGGCGGTACCGTGAGTGGCCTAGGCAAAggcatcaccatcagcagcattggcgtCGTGCTTAAGTCGCTTGGCCTGCGCG
TCACGTCCGTCAAGATCGACCCGTACCTCAACTGCGACGCCGGTACCATGTCCCCGTTCGAACACGGCGAGGTGTTCGTGCTGAACGACGGCGGAGAGGG
AGATCTGGACCTGGGAAACTACGAGCGCTTCCTAGGCATCACGCTCACGCGCGACCACAACATCACCACGGGCAAAGTATACacgcaggtgctggagaag
gagcgtcgTGGAGACTACCTGGGCAAGACGGTGCAGGTGGTGCCTCACGTCACAGACGCCATCCAGGACTGGATTGAGCGTGTGGCTCAGATCGGTGTGG
ACGGCAAGCACGCTGgcgaggctgctgctgtggatgacgaagaggctgACGTCTGCCTCATTGAGGTCGGCGGCACAGTCGGTGACATTGAGAGCATGGT
GTTCCTTGAAGCTCTGCGTCAGTTCCAGTTCCGTGTAGGACCTGAGAACTTCTGTCTGGTGCACGTGTCGTTGGTGCCTGTGCTGGGATCTGTCGGTGAG
CAGAAGACCAAGCCGACGCAGCATGCCATTAAGGAGCTGCGTAGCGCCGGTCTATCCCCGGATGTCATCATCTGTCGGAGCAGTACGGAGCTGGAGCCGG
CTACGAAAGCCAAGATTGGCATGTTCTGTCAGGTGCCTGCTAACCACGTGCTCTCGGTGCACGATGTGAGCAACATCTACCatgtgccgctgctgctgtc
caagcaGGGCGCTGCTAGCATTCTCATGTCCAAACTGCAGTTGATGGACCGCTTCAGCGAACCGAACCTCGCTGACTGGTCCGCTATGGCTCATCGTGTC
GACTCGTTTGAGAAGATGTGCAAGATTGCGCTCGTTGGAAAGTACACGGGTCTGCAGGACTCGTACCTGAGTGTCATCAAGGCGCTCAAGCACGCCACCA
TGAAGTGCGACCACGACCTAGAGATTGAGTGGATCGAAGCGAGTGACTTAGAGGTGGAGATGCGTGAGAAGGACCCTAAGGCTTATGAGGAGGCGTGGCA
GAAGCTGCGTAGTGTGGACGGTATTGTCGTACCTGGTGGTTTCGGCGACCGCGGTGTGGACGGTAAGGTGCTCACAGCCAAGTACGCTCGTGTGAACAAG
GTGCCGTATCTGGGTGTCTGCCTCGGCATGCAGGTTGTTGTGATCGAGTACGCGCGTAACGTGATCGGTTGGAAGGACGCCAACAGTGAGGAGTTTGATG
CTAATGCGGGACACAAGGTGGTAGTCTTCATGCCGGAGATCAACCCGGAGGTGATGGGCGGCACTATGCGCTGTGGTGAACGTCGCACGATTGTCCACGA
GAAGGAGGACCCGGCGAAGCGCTCGCTGGTGTCGTACCTGTACGGCAAGGACAAGCCCATTCTGGAGCGTCACCGTCACCGATACGAGGTGAACCCCGAG
CTGGTTCCCGCTATCCGTGAGGCTGGCCTGAACTTTGTGGGTACGGACACCAAGGGCGAGCGCatgcaggtggtggagctggaccGCGATATTCACCCGT
TCTACTTCGCTACGCAGTACCACCCGGAGTTCAAGTCTCACCCGAATGACCCGTCGCCGCCATTCCACGGTCTTGTCCTGGCTGCCACTGGCCAATTGAC
CAAGTTCATGGAGGAcgtggaggccaaggagaaggaagcgTGA