Transcript Name :
Phyke_g173
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Phox homologous domain8.882PS50195
G-patch domain10.441PS50174
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-944
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
nucleic acid bindingGO:0003676IEA
*** None ***
*** None ***
Sequence
        3773 bases(100 bases per row)
ATGAGGAAGTCCATTTCATTTCCGATCGCTCCACCTTTGAAGCTGCGCCGCCGTAAATCGCTGCAGGACACGAAACAGAGCCACTCGTTCTCCTTCACGA
ACCGCCGGGTGGAGAGACAATCGTCACGTCCGCGTCTGACGTCCATGCAGTCCAtggagcagacgctgctggactgCGTCCACGTGGAGTTCATTAAGGC
CGTCGTGCCTGGCCAAAACAAGCTCGCGAGTCCGCGCTACATCATGCGTATCACCAACACAATGCTGGACCAGACATGGGAAATGGCACGCACGTTCAAG
GAGTTCTACGAGCTCAAGGAGTCTATCGTGAGCTTGCTCGACTACGGCCATTTTTGTCCCTCCAATTGCCCGTGGCTCTACATGTATGCCGCCCACCACT
TCCCGCGACGCCGTATCTTCCGGTCTCGAAGGCCGTCCGTGATCTCTAGACGCATTTCAGACCTGCAGACGTACTTCTCGACGTTGCTGCGTATGGCCAA
ACAGAACCGGAATCTCGAGTGTTCGATCTCGTCCACTAAGCTGCCTCAGCTGATTTACGACTTTTTGTTTGAAGGAATGGTCTTTGATCGCTCCGATTTC
CAGCGTTTAAGCGAACGTCCTTCAATGGGTGGACGTGACAGCAGCTTTCTCGACAATGACCCGACCCAAGAGGCTGAGGGGTGCTCTATCTGCCAACAAC
CACTGGTCGGCGACTCAGCAGTGTCGATCGTACCAGCAGGTCCCTACGGCAGCAATCGTGGCCGTGCAAGCtcaaacaacaagaaccgTGAGAAACGCGT
GATGGCGGGCTTAACCACATTGGATTGCGGTCACTGTTTCCACGATGAGTGCATCCTGGTAAAGCTCAACGAGTCGTTGAAGTGTCCGCTTTGTGTAGCT
TACAATAAGGCCAGCTCACTCGACGACCCTGTTGCAGGTCCCTAAGCTCCATTTCAAGGTTTTGTGCAGCATAGACCACCTATGAAGCTGAGTGAATAAT
GTCATAATGGGACGGCGTATTTTAAGCCAAAACATTTCATCAAAAGTTTACAGCTATGGTTCTGCGTGTTGGCGCCAACGGACGATTGTAGCCACCTCCA
TTAGAGGTACTGTCTGATCTGTCGTCTACAGCACACGACAGTACCACAAAGGCTAGTACATTTTTCATCCACTCCACAATACCATCTGTGACCTTATCTG
AAACGCTCTACATTTGCCAACCATTAAGCCAATCGAGTATGAAGCGTGGTGTCCGCAACCAAGAGGTGCGTCTTCCTCCCTCTCTTGCTCTGTAGATGAC
CTTGCTGGCCTTGTAACCCTCATCCTGACATATATATGTATATTGTCATGCTTTTTCGCCTCTTTCCTGGCTGTCAACACGCAGGTAACGGACGCACAAG
GCCGCCGACGCTTCCATGGAGCCTTCACTGGTGGCTTCTCGGCTGGATACTTTAATTCAGTTGGTACCAAGGAAGGATGGACGCCTAAAACCTTCTCGTC
TTCACGTGATGACCGCTCATCGCGGTTCGAGCAGCGTGCTGAGGATTTTatggacgaggatgacgatcCATTGCTAGGTAAAAGACTGGAGACAACAGAA
CGCTACGATACACTGCAAACTGGAGCCAAGAGACGACTGCAACAAGCTGCTAGtactggcgctgctggaggtgcaACGATCCCTGGATTTGCATTGCCAG
ATGACTGGGTATTGCCTGTGAACGACTCGATAGGGGCTACGCTGTTGAAGCAGATGGGCTGGAAAGAAGGTCATGGTATTGGCCAACGTGTGCGAAAGCG
CAAGTTCCAGGAGGAGATTGCAGAAGATAAGAACACGGTGCAGAATGCAAGTGAGAAGAAAACTGAGGAAGGAGGTCATagtgatgctgaagaggaggtt
TATGTACCTCCTCGAAAGATGTTTGATGTGCAGAAGGCGTTCCCGAAGCCGAAGTTGGATCGCTACGGTGCTGGGTTTGACCCGTACATGAATGCCCCTG
AGTTCTCTCGATacaaacaacagcaggaagatAAGCAGCGGGTACAGCAAGGGTCTCACCGCCAGATAGTTTCTTTTTCTGACGCCATGAAGTCTACTAG
CGGCAGTAATAACTCGACAACTGCTTATGGACTGAGTGCGCTGGAAGAAAATGATGATGTAGACGTCTACGGGACTGTGTCGATGGCTAATTTTGATCGA
GTTATTGCTCCGCTTGGGGGCAGGAGCAACATCAAGCGATTAGATTCGTCAGCTCAAGAGTCCCGACGCCATGAGAAAGTAGGTCGTAGCCGGTCGTTGT
GTTCCGATGGACGGCCGGTACTTCCTGGGTTCGAACTTACTATTTCCAAGGAAAAACCACCAAAGTCGGTAAACTTGCGGCTTGCTGTGCCATCAGGGTT
TAAGGGATACCACCGGTTCAAAGAGGACGAAGGTCAGGATGACGTGGTGGCCACGTTATACCGCAGATACCATTTGTCAACAGataacaacagcaacagc
gcgTTTGTTACAGCAAGACAACGTGGTGTGTTGTTAGAAGAAACTAAACGCGGTGATGAAAGTGtgactgttgttgctgacaCAGCACCGTCCAGTGCAA
TAGGTTCAACTGGAAGTGTCTTCGATTTACTCGACGAGGAACAGAAAACTAAACTCTTACATGCTGTAGCGCAGGGAAAGCAGACCCCCCTACCGCAGAC
GGCGCCACACCCTGCACCTGCTGGCGTTGAGAAACTGCCTGTACCAAAACCACGACAACATTTAGTACatggcaatggtggtgaAGATTTTCGAGCTACA
ATttcagcatcaattgcaaAGAGATTTGTGTCGTCGAACAATTCAGCGGAGGAAAAATCGACAGAGCCTACTCGCTTCCAGACAACTCAAGCTAAGGTAT
CGCGGCGGTCGCAGAGTTTGTGGATTCCCAAGTTATTGCTCTGCAAACGATTTCACGTCAAGTGTGCTGGTCCGACCGGTTCTAGCGGAAAAGAGGATGA
CAGTGACAAGAAGCGTGACTTgtttgatgaagagctcGTTCCTCACTTGGTGGATTTTGCCGCCAGTCGAGCTACTCGTTGGCAGCCAGAGAAAAAGGTA
TGTGAAGAGTCAATGCCCACTGCGGATGATAAAAGCAAGCGCGTCGATGATGAGGAGCTTccaccattgccagcagTTGTAAAGACCTCGGCTAACCTGC
TCAAATCCATTTTTGAGCCGTCGGACGAGTCTGATGTGATCGAAAGCGATAGCGACGATAGCGACGGTGACGATGATACGCTCGGTAAAGAGAAACATGA
TGAGGAGAAGCAAGATCCTCAACCTAGCACACGCGCGGGAGACAAGGCCGTGGGTGGCGCCTCAATTTTCAGACAAACGTCTCTGCAGCCCAGTCGAAGC
TCAATAACTTCGGTTGAGTCAAGTTCatcagaagatgaaggtATAGACGCAACACCTATCTCGAACGACCACAACGAAGAAATAAAGCGAAGCAAAAAGC
GCATACACactgatgatgacgaagaccgTCGGGGTGCCCGAAAAGAAAAgcaaaaacacaaaaagcacaaaaaacATCACAAGCACCGTTCATCACACAG
CGACACGGACAAGAAGCGAAAGAAAAGTAAGGATCGGAAGGAGCACAAGCACCGCTCGTCGCGACACTCGAAACGAAGTAGAAGTAGAAGCGTTGAGCGA
AATCGTGACCGTCACCGTAGTTCTAGCAGAAGACACTAATCGAGGAACGTTGATAACTCTGAGAGCAGTGTAA