Transcript Name :
Phyke_g179
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_476843
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, B-box10.537PS50119
Zinc finger, B-box11.249PS50119
HmmSmart predictionP-Valprediction_id
Zinc finger, B-box4.4SM00336
Zinc finger, B-box0.004SM00336
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-799
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
zinc ion bindingGO:0008270IEA
intracellularGO:0005622IEA
*** None ***
*** None ***
Sequence
        2400 bases(100 bases per row)
ATGGTAGTGAACGAGGGCGATGAAGCAAAGGCGAGTGCGTCGCTTGCGCGACTAAGGCTTTTCCTATCGTCGCATGCCCCGAATGGATCAAGCGAGTCGA
CTCCATCTGCAAGCCCGGAACGcccagctgcagcagtgcaagaaAATGGTGGCAATGATAACGGCACCTCTCCATCAACAGCTGAACACTCCGAGTGGGG
AGCTGGAATTGAATCGTACCCTGAATTTTTagccgacgacgacgaagatgatggtggcCAGACGACCATCCCTGCTGCAGGGGCAGTAGCTAGCGTGACG
CCAATGAGTCAGTCGTCCAAGGAATTTGCACGCGTCAAGTACTTACTACAGTGTTCATTGCCGGGGTATCGCGTGCATGAAGGTGTCGTGATTTGGGATA
TGCGGAACCCGTCGCTAGTGGCGCAGTACGAGCAGCACACAACAGGATTACTGGAGCTCGAGTCCTGGGTAGCCGTTAATGACCTCGGTGCCGAAATGGG
CGACGTGCACAGCTACGGGTTTACATCACTGGACGCTAATCAAACGGGCATGAAGTTCACGACAGGGAACCTCCAGCTTAGCGCCCCACCACCTTTGGAG
CCTTCGGCAGAAGGGAATAAGGCAACAAGCACACGGcagttggtgctgtgcaaGATTGCAGTGGGGAGATCGCTTGTGATCcgagaggaggaagaggcaa
AGGCACGCCTGCCGGTAGGTTACCACAGCTACTACCTGCACCGTGACGATGAAACTGGATCCAGTGGTCAGGAGCAGGACCCGAATGGTCTGcaagcagc
actgctggatCGTGGCTATTATCACGAGTACATTCTAAACAACACCCTTCAAGTGTTGCCTCAGTATCTCGTGCGCTTTACTTTTTCAGCTGCGGATGCG
CACGGTCCCGTAGGACCCTGTGCACTCTGTGAGCAGCATCCCGCGGTTGTCATCTGCCGCAATTGTGAGGCGCAAATCTGTGCGCATTGCGACCAGGAGG
TTCACTCGGCCAACAAATTAGTGCGCCGCCACAAGCGCACTCCTCTGCGTAGCAAGTCCAGGGCCATCGCGAGCGGAGGTGCTAGACGTGGAAGGCGTCG
TAGCTCAACACCATCGCTAGCTGCCGCCATCGTAGAGCTAGGTGCAGAAAACATGACGACTCCACCTCCGCCTCCTGCTTCGAACTGCCCAGAGATAACG
GACGTCCAGATCAACACGATCGTCGCGAAACAAATGGAGGAAGGTTTACTCGCTGACGAGACCCGGACACCAACGTGCCGCGCACACCGCGGCAAAAAAG
TCGAATTCTACTGCCCTGTATGCCAAGTTCCAGTTTGCGTAAGCTGCAAAATGATCGGCGACCACTCGATCGGAGAGAAAGGTTCGCACAGACTGTTAAC
CGTGGCAGACGCGTACGAAACTTGCCTGCGTGAGTCGCTACGCTCGGACCCACTCATTGCATCGCGCAAGACTGTGATCGAAAACAAATTGCAGTTTCTA
ACTCGGATTCAGCGCAGCGTGCAAGAAAACAAGATGCAGGTCGCGGCTGCCATCAAGGAGCAGTGTGCACTCGCACTGCGCAATCTGAATGAAGCAGTCG
CCGTGAAAATGCGCGTGCTGTCCGGCGAGTCGCTTGAGTTTGAGCGGCAATTGCAACAAATCGACTGGGTGGACGAAAGTCTCGAGGACCACCGCACGTT
GCTCCCACCAGTAGAATTCCTGTCCGCCTGGAGCCAGCATAAATTGCTTCGTGCCGAACAGCGTGACTTCCCTCCGTTTGCACACGGCTCCAACAATAGT
GCTGAGCAGGTGAAAGCCGACTTGCAACTCACGGGCGAGCTTCATGTCATGTCTGCAGAGCAACTGGCTACGCCTCACCATCGACAGACCTTCACGCctg
gcgacgacgacaacgacgacgacgttcTTATCAACGACATCGAACCAAGTAGCAGCAACCAAGGCAGTATTTCCGACAGTCCACAGGTAGAGTTGAAGGC
GGCCGCACTCCTCACTCACCACCGACGCAACCCGGACAGTGATATGCGCAAGCGTTTGCTCAGCATGAAGGCCAGTCTACCAACCAACATGGCATCACGA
CGCGTCGTGTCTCCCAAGTGTCAGCAGATATTGGACGAGATTCGTCATGATATGCTGACTCAGAatgccgccaagaagaacccCAGCGCAGTGTCGCCTC
GAGGTGGTGGGTCTCCACACTTTCGAACGGGTCGTATGGTTGACTCTACGGCCACTTTGAGAGCATTCTCGGTGCAACCAACCGCCAAGAAACTTGGAGA
TGACTCGACCGAATGGCGATCTCCAGGACCAAAACAACGACGCGGAACTAGCGCTTGGACGACATTGCTACGTCACGAAATGGAGCTCAAAAACGACTaa