Transcript Name :
Phyke_g181
Orientation:
(+)
Number of Exons:
2
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain21.137PS50297
Ankyrin repeat11.995PS50088
Ankyrin repeat12.048PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat1200SM00248
Ankyrin repeat0.011SM00248
Ankyrin repeat3300SM00248
Ankyrin repeat210SM00248
Ankyrin repeat6.5SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-479
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1506 bases(100 bases per row)
ATGTCcgaggagctccaggagGCGGTGgacggcttcttcttggcggcgGAATACGGTCGCTCCGACGTGATCAAGGCCTTAGCAGACCACGGCCGTGGTC
GTATAATCCTTCGCGATGTCATAGACCCCGTGACAGGTCGTTCGCCTCTGCATGTGGCTGTAGCAAGCGGCAAGAAGGACGCAATTCGAGTGCTTTTGGC
TGCTGGCTTTCCCCCAGACGTTcagagcaacagcaacagcaatacacAGGATGAAAACTGCTCTGCATATGCGTTAGCTCAGCATTTAAAGGCCCaagag
ctactgctggttttccaccagttcctggtgcagcaggtggctgCCAACGACGTGGAGAGTGTGCGGCAGTTGATCTCTGCTGGTGTGGACGTCGCCGTGA
CGGACACAGCTACAGGAGGTTCATTGCTGCACTGGGCAGCGTCTTGTCAAGCGATTGACGTGATGAAAGATTTGCTGGAGAGAGAAGATGTGAAgcggaa
gaagttggtggatTGCCGCAATAATGACGGAGCAACGCCACTTCACTTGGCGTGTCATGAGAACCAAGTGGAGTGTGTGAAGATACTGTTGATGCACCAT
GCGGATGTGAGTCTTAAAGTAATGAAGGGGTTTAGTGAAGGAAAAACAGCGGTGGAGGTAACTACGTCACAGGAGATTCGGGAGCTGTTTACACAGAGTT
CTGAGGAGTCTGCAGCTAAGGTGATGCAGACGGAGAATGCTGTTGAAAATGATGAGGCGAGCACCAGTGGAGTTGTACCATGTGGATCGGCAGCTAGCGA
GCGACGAAACTCGAGGACATGCCCTCACGAAGCCCATAacaccaagctgctgctacaactTGAGGAGAAGGATCTGCTCGTGAACCAATTGAAGAAGACT
ATCGAAGTGCTTGTGCAGGAGTCACAGGAAATTCAGATGCTGGGAGAGGAGCGCGTGATGCTGGACTACGTACGAAAGCTACGTGATGAGAAAATGGTTG
TTCAGAGGCAGCTGGAAGATTCCAACAACCTTATCAAGGATCAACGGCATCAACTGGAGTGTCTTAAAGGGCAGATTCGGCAAATGGCTACCGTGACTAA
ACAGGTACGGCCAGGTAGATATGCTCATTGACGACAGTAAATTCTGACGACCAATTTTTATGTGTAGCAGAGTGAAACTGACCACGACATTCTCTCTCAT
ACCAGTGATGGAACTGTTAGCAGTGCTGCAGGCCCTCCAGACAGtaacaacagcgacagcagtgtACCCGATGACCATTACTCGGAAATGCATctcgatg
aagaggatgggCACCAGGAACCTCGAGCTCAACCATTGAAGCTGGATGCCTGGACCTCGAAGGCACAACGTGAGCAAGAAACATTCAATCGATACGTCGA
AAACCACGGACCTGACATCTGGAGTACTATGTGGAACGGCATCTTTACAGGTAACGATGAAGGCGGCACGCAAGATGAGGATGGGGAGATTATCATGACA
GTGTAG