Transcript Name :
Phyke_g138
Orientation:
(-)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-113
174-245
308-342
408-485
137-150
269-287
366-384
114-136
151-173
246-268
288-307
343-365
385-407
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4023 bases(100 bases per row)
ATGACCATGCGCCTTCGTTTCCAGAAGAATGGCAGGCGGTTGGGTGATTTAATGCCCGGGCTTGCAGGTGTGTCGGGGATTGAGCTAGGGTCTGAGAGCA
CCGACCTTAACGATGCTGATTTCTTCAAGCCGCAGTGGGTTTCAGAGGGCATGGGCCCACCACACAACCTGTCCGTATCGGATAGGGCGAGTGTAGTCTA
TGAAGCAACAACCTTGCTGGCCAAAGATAGTGAAACCGCGCGGAAGCTTATTTTTGTTGGCTGGCAGCAAATTCGTTAGTGATAACTCCGAGCTAAGTAA
GCACGTTGGGCTTGTAACATTCGTCGGGCACTGACGTGGTAACTCGAATCAATGTCCAACCGACCAAAACCTGCCACAACCGTCTACGCGCTCGTTCCGG
CTCAACCCCTACCCGAGGTGGACCTGTCCAAGTCTTTCAAAGGCCGAATACTGCCAGCGAAGGTTCACACTTGTATCCGCCGACATTACTTCAAGTATGA
TCGACAATTTTTGATTTGCGCAATGGTAGCGTATTGCCTGAATATCGCGATAGCGATGGTGACAGCACCAACGGGGAAAATATTTGCTTTGGCGAGTGTT
CTTCTGTGGATTCCGCTCGGACTTGGCAGCGTGACTACACTGCGGTACGATATTGTGCGATTAGTTTGCCGAACTTTCGACTTCTGGTTCTCCTCGATTA
CGACAAGCGTGATTGTTATCACGACTTCAATGTATTTTTCGGACTTGCGCTGGACCCGGATGGTTATCTATTGGTTTGGGTTCCACCATGTCATTTGTAT
CGATGCGCACGTATTTGGCCTCAGAAGCCTTACATGCATCATGATTGTCGGAATGTTCTCGGTTGCTGTTTTACTCACTTGGATTGCCCTAGGGCGAGTT
GATGGAGGTTCCACCTTCACGATTCTGAAGTACGAGAATGAGCACAACCATTTTGAACTATCCGGTGTCGACGTGATTGGTAATGGCCTCGTAACACTCG
GCCTTCTCCTCGCCAAAATTTCATTCCGAAAACGCAAGGTGTTCTGGGAACGAAACTTACGACCATCAATTGCTGAATGTGTCGTCTATCGGTGCAGGTT
GAAGTTAGAGTCGATCGAGGGGCCAAAACTAGCGAATGCGTGGCCAGGGAATGAATCTAAGCGCAGCTCAAAAGAAGACTCGTTGAAGCAGCCAGATGCC
GTCCAACATTTGATGTTCCTCAAGTTCCCGCGGACATTTGACGCTACCGAGACTCTCCTTCCTTGGAGACTGGCACAATGCGCTGTGTTCGCTGAGTTTC
CTGCGTGGCTACTCACCATTATCTATACGATCGGAGCTGCAGGGATATTTCTCTCACACATTACGCTTGTCAACGATTTCGGCGGTTCCAAGGACTCCTT
GTGGCACAAACACGTCCTGCTGGTGACGTCTTCTATCGCGTTAGTGTGCACCCTCATATTTATGGCCACCTTTGTGGCTTTCTACCAGCGTCAGTtgctc
aagctgctcttcaactCCTTCGACTTTGCCTTCTACTCCTTCCAGATCACGTCGGCCAATATGTGCGTCTGCACATTCTACAACTGGAATCCCTCCCACT
GCCTCATGGCGCTGTCGTGGTCGCTTTTGGCTCACTGGGCGTTCACGTTGGATGCGTTGACTCCGGTGATGCGACGTATGCTTAAGTTCCGCGTTGGCTT
TGCCGCCGCTGTGGTATGTCTCCTGCTCGTCGACCACATTACTATCATGTACCGAATTTTCATCGTCGGCGAtatggagctgcaggactcGGTCATATTC
GAGGGAACCGTTTGGAGCCAGCACCTGGTTGTTCGTGTCGTACCATTCTACGCCAGTCGCATATTGACGCTTGTACTGTGGTGCTCTCGCCTCATTATCC
GGTTGGGCTCGTCGTCCATTGATGAAGTCACGATTCTTCGTGGCACAGTCTGCTACGACAATTTTTTCGCGAATGGAAGACAATTGAGCACACAGCTAGA
AATGGTAGCCGAAGGGAAAACTCTGAAGTCTGGATCGAGCGGCAATCAGATATTACCTGCTTGTCCAGATAGCCGAAATATTCCTAAGTAGAGAGTCGTA
TTAACCATGTCGGCTTGAGTTAGTCGATGGGTGTCGCAAACCCTCTTCATGGTGCTCGAGCAAATCAAATATAGCTTCTTCGTGCATGCAGCGTAGATCA
CCGTTCACACTTAAAAAGCCATCGTTGTTGACCCTCAAAACCGTCTACCAACGATGGTCACTCAAGAAATGAGTACTCCTTGTGGTCTTGTGTATTCCCT
TGTACCAGCTAGACCGCTTCCGCACATTGACTTGTCCAAGTCAGTTCGAGGAGAGCTGATTCCGGCAAAACTTCACGCAGTAATTCATTGTTTTCTCGCT
AAGTACAATACGTCACTTCTGCTGGGGAACATGACCGCCATGTTGCTTAACGTTGCCGTAACGGCAGTTAACGCACCAACTGGACAAATTCTTTCGGTGA
TAAGTCTCGTGTTGTGGCTTCCTTTGGGTCTCGGTGCTCTAAGTACAATGAGATATGACATCgtgcgtttgctgctgagaaCATTTGACTTCTggttctt
ctcctgcacGACGACATTAACAGCTTTAATGATATCGGTGTATTTCTGGGACTTTCGCTTCTGTCGGATGATCATCGATTGGATCGGGTTCCACAACCTT
GTGCTTATCGACGGGCAGGTGCGAGGAATTCGTGCTTTTACCTTCATCACAGTGCTAGGGACCCCGCCCCTGATTTTCATGTTGATCTGGATAACACTGG
ACCGATTAGATGGATGCACCAAGTTTTCCATCTTgagccacaacaacaaacatGGGGGCTTCAGTCTCTCCGGTATGGATGTCATCGAGAATGGCTTGAC
AACTCTCTCGCTACTCATCATAAAAATCGTGGTTAGAAAGCGGCAGGCACTGCGGTTGCAGCAAAACTCATCAATGATTAAATGCGTGATCTACCGGTGC
GATCTGAAATTCAATCAAATCGACGGCCCGACAGCCGTGCTTAACCCAAGGACTCGATCGAGGAACACATCTACGGGTCATCGTGGTATTTCTACCTTTG
AATCAACTGGAAGCACGACGCTCGAACCGACTTTGGTCCAGCAAATGAAGTTTATCAAATATCCGCAGACATTCCCCTCGAATCACGTTGTTTTACCTCT
ACGGATTCATGGCAGTATTGCCATCCTTTTGTACGCCACGGGTACCATTGGATTCATTCTATCATTTTCTGTTCTTGTTAACGGCTTCAACGGTGCTCAG
CGTGGTGTATTACTCGTACAAGCGTGGTGTGCAGTGGTTTGCACACTAGCTTTTATGGTTCCATTCGCAGCACTTTATCAGCGGCAACTCCTCAGATTCC
TCGTTACATCGTTCGACTTCATTTTCTACGCCTTCCAGATCACCATGGCTAACTTGTGTGTCGGCAAGTTATACAACTGGGAATACTCACGATGTCTCAT
GCTGCTCACATGGTGGATATGGTCCCAGTGGGCCCTCACACTTGATGCACTTACGCCGGATATGAAAGACAAATGTCGCTTTCGCGTACGCTTTGCAGCC
CCCGTTGTTGCACTTTTGCTTCTGGGTCATATTGTCATTATGAGTCGTCTCTACTTCATAGGCGACCAGGATCTACAGGATGCCATTATCTTCCAAGGCG
CTGTCTGGGAGCGCCAACTGATCATTCGAGCTATACCATTCTACTTCAGTCGGGTCGTGACACTGTCGCTGTGGTGTCCGCGCTTGATCTGGCGCTTGAA
CACTGCGTCTAAGATGGAAATGACGATTCTGCGGGGTTCTGTGTGCTACAACAACTATTTTGCCAAGCGGGGGAAGCGACGTTCGCGGACTGGCACAGCT
AGTACAGGCCAGGAGAAAAAGCCCCAGCGAATATGTCGACGGGGCCGTGTAGAGCCTGTCACACTTCATAACAGCCGTGGTCCCACAATTGCAAATGCCC
TCACTGCTATTCAGCCGCAGTAA