Transcript Name :
Phyke_g144
Orientation:
(-)
Number of Exons:
4
Description :
hypothetical protein PHYSODRAFT_553039
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Protein kinase domain33.135PS50011
AGC-kinase, C-terminal10.229PS51285
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-849
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
protein kinase activityGO:0004672IEA
protein serine/threonine kinase activityGO:0004674IEA
protein phosphorylationGO:0006468IEA
*** None ***
*** None ***
Sequence
        3100 bases(100 bases per row)
ATGGACAGCAGTCGACGAaccagcgtcagcagcgccagcagcagcgatctgGAGAGACTACACGAAGAaatggagctggagatcaaaccgcagaagctgc
aacgaCAGTATACACTCAGTGTCCCACCCACTAGCAGCTCCATCACACGCAGTGGACTGCCAGACACGTCTTCAGGTGTCCCAGAGGACGTTCTGGACCG
CTGGGAGAAGAATCAGGTGAAATGGAGACGACTTACGGCCAGTGGGGACGAACTGAAGGAAGCTTTGGGTGAAGACGTCTCTATGGACGCTCCACTGTTC
CTTGAGGACGGAGACCTGTTCGTAGACGTCCCGAGAACTGAGACCTTTGATGTGACATTCGGAGACGGGTTTCTAGGCCTAGAATTCGTGTTTGACACGG
CGAAAAACCAGATTTTGATCAAAAATGTGATGAATGATTCCGGCTCGAATGCAATAATGCTGATCCCTCCGGGAGTGAATCTGGTACGAGGTCTGGCAGT
GGACGCTGTGAATGGACAAGATATGAGCGCTATGTCACCTGAAGACGTACTGGATAATTTGCAGTTCAGTAAACGCCCCATGACTGTGAAATTCCAAAAA
TCTGCCAAGTCAGTGGTCTGCAAACTCTGTGAGACCAAAGTGGATGCAAACAGTTTGGATGAACACACCAACTTTTGTGTCTTGTCGAAACGAGTGGAGT
TGGAGGCGGATGTGATCAACAATTCGCTGGCCAAACTGACGGCGTCAATTTCTGCGAATCTGGACACACAGGCCATGAGACCCATGTTTAGTCAGGAAGA
GATGCATATTTACCATGCGTTGCGTGTGGCAGCGATCCAAGCATCTACATGTGATGTCACAAGTGTGGACTCGTTCGCGTTATGCTCCAGATTGGTGAAA
ATCATAGACCGGATACGGGAGCAGGAAAAAGATTCGCCCAACTATGCAATAGAGCGAGGGGTCAAGTACTGCACCAAGCTGCGCAACTTGATCCATACGA
AGATGAGCAAGATGCGTGCATCGCACAAGGTAATGCTACAGCAGAACCCGGGCGAGATCATGCGTGCACCTTTTAAGCGGACCAAGTCactggaggagct
cgagaCTAACAGCGGGGTTAAAACACCACGTCGCCGGAGCAGTTTGAAGCTTTCTTCCTATCGTGTTTCTATTCGCGACTTTCAGATCATAAAGCCGATC
TCGAAAGGAGCTTTCGGCAAGGTATACCTGGCCAAAAAAAAAACCACAGGCGACCAGTATGCGATTAAGGTGCTCGCGAAGGAGCACTTACTTCGAAAGA
AGCAGGTACAACACGACCTGCGTAGTGCAGCGTGCCCATGGTGCCGTTTACTGAGTGTATGCCATTGTGGTCCCTTTGTTTATTGCCAACAGATTCAGCA
AATTGAAACAGAGAGAAATATTCTGGCCAGTGTGGTGAGCCCATTCGTCGTGAAATTGTTCTGGACATTCCAAACCAAGTAAGCAGGGACATTCATACTT
GTGGGCTCTGTCACACTGTAGGTGCTTACACTGGAGAAATTTGTCATGTTGGTGTCACCAGGCGTAACCTGTTCTTAGTCATGGAGTATCTTCCTGGAGG
CGACTTCATGTCCCTTCTGGAGTGTATTGTGCAGTTGGAAGAGCAGGTGAGTTTGCAAACTTGTGTAAATGCTCTCTATCTGTGTGCAGTATCGCCGATT
AATGTTAACTTATGCGTACAAAGGTGGCATGCGTCTACATTGCAGAGATCGCAATCGCATTAAACCACCTGCACATGAAAGGATGCGTCCACAGGTTTGA
AAAACAGCTTTGCTTATTTTCAATTGAAATCGCGCAATTATGCTCAACATTTGCGTTTGACTATCCCACTTGTCTGGTCTTTGGCATACGAATGTATAGA
GATCTGAAACCCGACAACATCCTACTTTCATCAACCGGACATATCAAGGTACGTCCAGTAGTTTTGCCATAATTTATACATCAAGCGAGTTTATCCTAAT
GTCGTGCTTTGCTTTACTTCTGATAGTTGACCGATTTCGGCTTATCGGAGGAAGCGGTCGCACTCAGTGACACCGATTCGGAGCCTGACGATGAGTCAAT
GACCCACGACAACCAGTCAGAATTATTGCCTGGAACTCTGTTGGATGAGGCATCAACAGCGCTCAGGTTTGACAACCCGCGCCATGGTCCCTCAAAGAAA
ggctccaagaagaaatctGCGTTTCACACGTATGGCCGGTGTGGCACTCCGGATTACTTGGCACCTGAAATCGTCCTTCGTGTACCACATGGCCCGCCTG
TGGATTTTTGGGCCCTTGGTATCATCCTTTATGAGATGTTGGTAGGCTTCCCGCCTTTCAACGACGATACCGTGGACGCAATCTTCGAAAATATTCTCGA
GCGGCAAATTTTGTGGCCTGATGGCGAGAAATGCTTGTCTCTTGAAGCAATGGATTTAATCGATAAGCTGCTAGACCCAAATCCGGCCACCCGCATGGGT
TGGGAAGATATTCAGTTTCACTCTTTCTTCGAAGGCGTCAACTGGGACACGATTTTGGAATCTGTGCCTCCATTCGTGCCAACTCTGGAGGGGCCAAATG
ACACCAGCTACTTTAACAACCGCAATCTCACTGACATTttcatcgacgacgacgagttcgacgtGAACTCCCGttctaccagcagcagtcagAACAACAT
TGACTCTGGTCCTGAGAGCGATGATTCGCTGCCGAATCCGTTTGAAGTGAAAGGAGGGCAAGACGGCGATACTGTTGAGAACAATACCGATAGTAACGCA
GAAACTGCAGACGTGGATATGTCGTGGGGTCTTTCTGGAGCACTAAACTCGTTGAGTGCAGCACCTCAAGCCCTAGAAGAATACATGGGCGACGAGGTGC
AGGTGGATGACAACAATAGTCACCATCGGTTCCCCAGCGGAATGTACGGTAGTCCCGAAGATTCTAGCCTCTCAGATGCCTTCAGGTCATTCAGCTTTAC
CAACATGAAcgctctcgctgctgcttcgcaagctgaagctgaaaTGATCGTCGACACACAAGCAGCCAATACTGCGTCCGGCCCATCAATTCTCATCTAG