Transcript Name :
Phyke_g158
Orientation:
(-)
Number of Exons:
1
Description :
sodium/glucose cotransporter, putative
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Sodium/solute symporter57.793PS50283
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
43-128
184-203
259-270
335-354
431-450
506-509
575-608
1-19
152-160
227-235
294-316
378-407
474-482
533-551
632-632
20-42
129-151
161-183
204-226
236-258
271-293
317-334
355-377
408-430
451-473
483-505
510-532
552-574
609-631
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
transporter activityGO:0005215IEA
membraneGO:0016020IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        1899 bases(100 bases per row)
ATGGTTGAGTTATATACTCAGACGGTGCCCGACACCTCCGGCGGTGCCAAAGTCAACGCCGTCGACATTCTCATCATCGTTGCGGTGCTCGCTTTCACGA
TGGTCGTGGCCGTCATTGCCAGTATCCAAGCCGGAGAAAGTAACCTGGCCAAATTCTTCCCGTGTATTCATCGAGCCAAACGCAATGAGCAGGAGGTGTT
GGAATCGCCAGGCGATGCCTACCTCGCCCCGGAGACCACCCCGGGCAAGAAGTTATTCGCCGGTGACGAACGCGGGTCGTCAATCTCTCAACAGAGACTG
TCAGCTTCACTGATTGCTCGTGACGGTCCGAATCACCAAATCAACGAGGTATCCAACTTTTTCCTTGCCGATCGGGGGATGCAATGGTACTTTGTCGGTG
GTGCACTGTTTGCTAGCAACATTGGTGCCGAGCACTTCATTGGCATGGCTGGTGACGGAGCTCGTCGCGGCATTGCGGTGGCGATGTATGAGTGGTATGC
CGCGATTTTAATCTTGTGCCTCGGATGGATCTTCTCCCCTATCTACCGCCGCTGCGGTGTGTACACGACCCCGGAGTTCCTCGAGTATCGCTTCGGAGCT
CCGTGTCGTCACTACTTGTCGCTCATCACGATCATCATGTACGTGCTGACGAAAATGAGCGCGAGTATCTACGGTGCTGCCATTGTCTTCCAGGCTACAT
TGGGGTGGAACCTGTACTTTGGTGCCGGTGTCTGCATTGCTCTCAGTGCCATGTACagcgttgctggtggtctACGCGCTGTGATGTACACGGACTTGTT
CCAGATGTGCGTGTTCACGATTGGTGGCCTTGTGGTATTCGCGTACTCAGTTAGCCAGATTGGCGGCTTTGAAGCTATCAAGGACAATCTTGCGAACCAA
GACCGCTCGGGCTGGTTTCACTTATGGAAGCCCACTGACGATCCCGACTACCCGTGGACAGGTATGATCTTCGGTCAGCCTCTGGGCTCTATCTGGTACT
GGTGCATGGACCAAGATCTTGTGCAACGTGTGCTGTCCGCCAAAGACACAGCCAACGCAAAGGCCGGATGCTCGTTCGCTAGCATGCTAAAGGTGCTCCC
GCCGTTCCTGATCGTCATTCCAGGCATTATTGCTAGCATCTACTTCGACTTCAGCAAGATCGAGGATGGCACCGACGCCGCCTACCCAACACTGCTCACT
GAGATGATGCCGCACGGCATTATCGGCCTCATGATTTCCAGTATCATCACCGCTATGATGTCGAGTTTGGCGTCTGTGTTCGCTGCCGGCTCGTCCGTCG
TCACTAACGACATTTATCTGAAGTTCCGTCCTGATGCCTCGCACAAGCAACTCGTTTGGGTTGGTCGCGTGAGTATCATAGTCTTTGCTGTGTTGAGCTT
TTGTTGGATCCCAATCATGCGCAGCGGCACAGGACTGTACGAGCAGATTGTGGAAATCCAGAGCTACCTGACACCGCCCATCGGTATTGTACTCGTACTG
GGCGTTGCCTGGGAACCGGCGAACGTCTATGGCGCGTTCTCGGCCATGATTGTTGGCGGCCTACTGGGATTTTCGCGCCTCATTTTCGTGACGATCAAGG
ACGACAGCATGGACGGCGATTTACCTGGAATCGTGAACACCTTTTTCTACATGAACTTCCAGCACTTTGCGCTGCTCCTGTGGGTTACGGCTATGGTTGT
GTGCGTCGTGGTAAGCCTTCTGACCCAACACAAGAACCCCCCTTCGGAAGAGGTGCGGAAATACATGATCCACTGGGACAAGGTCTTGAAACTCGATGCC
TCGGAGCTCGCCAAGCCTATGTGGGTCAATGTTCTAGTTGCTGGAAGTGGTATCGCTGCGCTCGCCATCACGTTTAGCATGTGGATTTACTTTGCATAA