Transcript Name :
Phyke_g160
Orientation:
(+)
Number of Exons:
8
Description :
hypothetical protein PHYSODRAFT_323450
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CHY-type10.419PS51266
Zinc finger, CTCHY-type29.44PS51270
Zinc finger, RING-type11.191PS50089
HmmSmart predictionP-Valprediction_id
Zinc finger, RING-type9.8SM00184
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, CTCHY-typeIPR017921
*** None ***
InsideOutsideTMhelix
1-337
NN-scoreoddsWeighted Score
0.5741.2690.003
*** None ***
TypeScore
nuclear783
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        1790 bases(100 bases per row)
ATGTTTCGAAGGTAATGATCCAAGTGTGTCGAAAATTTGTTAACCTTGTTACGATGGTTGTGAACTCATATTTTTGTTGTGTACATAGTGCTAGGCCAGA
ACACCACCATGCGCAGGATGAATCGTTCCCCGACCAAGTTACCAACCAAAGTCAGGAAGTGCGTCCAACGGCTCTGCCAGCGCCGCTTTCTGGTGCAGAG
GTATGCTAATGTATTAAAGAGTGTAAACATTCGACTCGATCTCATTGCGCGAATATTtcgctctctctcttttGCAGGCCACTCAGGCGTTGTTGAAAGC
GAAAATCCGTGAAATCCAGTCGAGCCCATCACTAACACCGAAAGAAAAGGCAGAATCGGTGCAAAATCTCATGATGAAGGACTGGAATGATTCCAGAATG
AAAGTGGGGGCGGCCAAAGCTGAGTGCGATGTCGATGGCGAGCGACGACAAAAGTCCTACCACGTACGTGACTAACGTATTGATCCGTATGACAACTCAT
TTTTCACCTATCTGTTGGCTGCTTCGTGTAGGATGAGGCAAAAACGATTTTCGGATGCAGTCATTACCAGTATGTGTTCGTCAAATTTCCGTTGGCACTA
GTATCCTCGACTAAGGTCTTTATTTAATTTGCTCCAGACGAAagtgcaagctgctgggaaAATGCTGCGGAAAATGGTATTCCTGCCGATTTTGCCATGG
TAAGTCCGCGACGATATCAGCATTTTCAACCCAAACTAGTTGCTAATAGTGCATCATGCTTGTCTTTACAGACGACAACGAAGATCACCCTTTCGACCGC
TACGCCACCGACACAGTATCGTGCATGAATTGTGACACAGTTCAGGTACACTTTCTGCCTCAACATCACGCTTGCCAATAAAAACCTGGTCACAAGTAAC
CTGGCACTGAtgacttgctgcttgattAACAGCCGATCGGCCAAGTTTGCGTGAATGAAGCATGCAAGAGCGAATTCGGTCGCTACTATTGCGAGGTGTG
CAGATTCCTAGACGACGACAAATGCAAGGAGATCTATCATTGCGACAAGTGCAAAATCTGCCGTATTGGCAAGGTTCGTCTTGAGTGCGTAGTGGACTAG
ATGTGCACATCACAAACTAACAATTAGAATTGTTTGTGAACAGGGCCTGGATATCGATTACTTCCACTGTGATCGCTGCAATGCATGCATGAGTATTAGC
CTCAAGAAACACAAGTGCGTGGAGCGATCGCTCGAGTCGGACTGCCCGATCTGCCACGCGTACATGTTCACCTCGACCACTCCGGTCATGTTCCTCCCCT
GCGGCCATTGCATGCACGTATCCTGCTACGAAGAGTACACCCTGGTACGTGAGCTAATGTCCATAGTGTTGGTATCACACCTTTGTCCAACCAGCTCACG
TGTGTTGTATATTGCAACCGCAGACAAACTACATTTGCCCGCTATGCTCAAAATGCCTGGGGGACATGGCACTCTATTTTGCCAGCATCGACGAGCTCCT
AGAACGTGAGCGCATGCCCACCGAGTACCAGGACTACAAGTCGCTCATATACTGCAGCGACTGTGAGCGCAAGTCCACAACCAAGTTCCACTTCGTGTAT
CACAAGGTAAGACAGCAGATGACTTTTACTACCTGAAAGTCATCACTCTATCTTCAGGTACTCACGATAACCTGTCGTGCTGTTCTAGTGTCAATACGGA
GAGTGCATGTCGTACAACACCAAACTGCTGCGCCAGTTCGCAGACCCCGACGAACAGGTTCCGTGCGGGCCCGTAACGCAAATGCAGTAG