Transcript Name :
Phyke_g172
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
START domain21.712PS50848
HmmSmart predictionP-Valprediction_id
START domain0.0031SM00234
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-236
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
lipid bindingGO:0008289IEA
*** None ***
*** None ***
Sequence
        711 bases(100 bases per row)
ATGAACTACTTTTTCGGAGAGATCCCCGCGGAGGAGCAGGTGAAGCCTGAGGAACCCACGTACGCCACCGCCGACGACGTGGACTTCGAAGCGTACGGCA
AAGAGAACATCCAGATCCTGCTGAACCGCCACACGGGCGAAGACAAAGTGACTACCTGGGAGCTCGTGGACGATGCAGACAACGTCTTCATCTGGCGGGG
AGCTGTGGAGGGCAGCGCCTGGAGTCCGTTCCGTGCTTCTCGCCGCATCAATGCCGACAAGCGCCTCATTGAGAAGCACCTGCTGGACCCGGACCGTACc
atggagctggacgacaTGATGGAAGCCATGGTGACGCTGCGGAGCATTGGAGACTCCAACCGCCTGGCGTTCCGTCATATCACCAGCAAGGGAGTGTTCC
CTATCTACGGCCGTGAGTTTGTGGTGGTCACACACGCCACAACACTGGAGGACGGACGTGTTGTCATCGCTACACGATCTGTCCCTGTGGCAGAGGTGAA
GCCCCTGGAGGGCTACGTGCGTGGTATTACCGTCGTTTCAGGGTACATCATCGAAGAACACAAGGGCGAGGACGGAAAGGTCTACTGTGAcgtgacgctg
ctggctcaCGCTGATTTGTCGGGCTACATTCCACCCTCGGTGGTCAACATGCTGGGGACGTCTGCGACTGTCAAGATTCTCGAGAACCTCGAGACCATGG
TGAACAAGTAA