Transcript Name :
Phyke_g169
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
BRCT domain17.318PS50172
BRCT domain9.918PS50172
HmmSmart predictionP-Valprediction_id
BRCT domain2SM00292
BRCT domain13SM00292
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
BRCT domainIPR001357
*** None ***
InsideOutsideTMhelix
1-1010
NN-scoreoddsWeighted Score
0.5921.6940.003
*** None ***
TypeScore
nuclear870
GO
*** None ***
*** None ***
*** None ***
Sequence
        3465 bases(100 bases per row)
ATGGAGTCCCCGCAGCCCCCAAGAAAACTGTCTCCACCTCTTAATACATCTCaccaagatgatgcagatttCATGGGCGTAAAAGACTCGTTCCAGCCTG
AGAACGACAGCTTTTCGTCCAGCCAGCAGTGTAGTGCAGACCCTAATGCTTTTCTAGGTTTCCACGTCACTTCAAGTGCTGAAAACATCGATCTGGAAGC
TTCACAGACATCTGAgacacagaagaagaagaaggaggagagaCTGACACTGGTCCTAGATCTGGATTCTAGTGGAGAAGGAACCACTCGAGGCTCAGAT
TTTGACCCAGCAATTAGTGCGTCCCAGTTGAGTCAAACCGAGAGCCAAGCGGAGATGAGGAACCAGTTCAGCGAACTCTTTGGCAAAGATACACAAGAGG
ATGAGGTTCAGTTGAAACAAGTTCAGCTGCCTTCCCCATTGAAGAGacaagagaagaagaaagagagaTCACCTCCAAGTCCTCCCTCCACAATGCTCAA
AGATGTGGAGAGTGCGTGGAAAGCGCGGAAACAACAGGTCGCtacggagaagaagaaggaggtcGATAAAGAGTTGGCTCTGGGAACGAGTGCCTTGTCG
GAGTACAGTGAGGACCTCGCTCCCAATTGTTTCCAAGTCGCGCATACTGCGTCATTTTCGTCATTGGACGCAGCGACTAAATGTGCAATGATATCTGAAG
GAAAGTACAGTGATAAGGCTGATGACAGTGACCTAGAGACGGACTTTGAAGATGAGATGGAGTGCACTCAAGCacttgacgatgacgaaaCTGATGACAA
TAAGCAGTTGACTCTGAGTTATGGTAACGCGAACGAGAGTGGAGTACACGTTGATGATACGGGGACAGAGGCTTACTCACTTTCAGATACAGGCACTCAG
CCGTATGGTGATTCTACATATAACGATGGTTATGAAATGATGGAAGGTGAGCAGAaagaagatgcagacatTACTCAGAGTGGAGAGAGCGCCATTTTTT
CACCGGTCGTTGATCCAACAAATGGCCAACGGGATGGTGAGAGCGAAAACACAAGTCGAGAGAGTTCTCAAATTAAGGTTGGTGATACAAGTCTAGATTA
CTTAACGCCGAGAGCTAACGTTACGCGAGTGGAGAAGTTGgttgcagctggaaatgcAACCACCGTGCCAAGTGTGATTGCACCAAACCACGCAGCTGAG
ACGGAGTTGGAAATTGATGACGACCAAGATGAGTGCATGGCTACGCAGCCTAGTGAAGATCGCCCCTCGGACGAACCAGCGGGAGAGCCGAGATCTACTG
CTGATCAAAATGGTTCGAGAAAGGGTGATAACATTCTGCTAGACAAGCACTTTGGTGCAACTGATTCTCATACGAAAGCGATACGCACCCTTGAGTTTTC
TTTCACCTCAACCGGGTCGCAGGAAAATGAGGTGCAGTTTGATGCAAGTCTTTCAggaatggagctgctcgcatCCAAGACAGCGGAGTCTGCGCCCAGA
AGTGCTCAAATGAACCCTTTCGAGTCCTCCATTAGTCCAGTGTGGCCACCGACACCAATCCCAGTAAATGACCTCTCTACCCCGGAGGACACTATCGTGA
CAAAGAAGAAAGTAGTGCTCGCCAAACGGAAAGAGGGTCCAAGCTCGTGGTCCGGGTTTCAGGCAGAGAGGAGCCAAAGAAATGTAGCCCAGTCGGATGA
ATCACTTAGCCAGACGAGTTCCACATCTAGTACAAAACGGAGGAAGCGCGGAATGTTTTCTCCTGATACGAAGGACTCGGATGGATCTGATCCGCAGACC
CCGCGGCCTCCTGTGCGGCGTAGCACTCGATCGTCGCAGTCAACTCCTTTGTCAACCCCTTCCATTCGAACCCGCGCTAAGATCCTCTCGCCGCTACCAA
TAAATCGCGTGTACAGTTCAAGATCTCAAACGATCTTTAAGTACAAGTTCGAGTTTTGTTTGACGGGTTTCGTGAACAAAGGCGAAGAAAcgttgatgga
gctgattAAAGAGCATGGTGGCAAAATTCCGGAGCGGTATCAAGATGTACTATACAAGAGCAATGCTAAGGCCGTAGTAATTGGTACCCCGGTATCGTGG
CGAAAGCGGAAATTTATGCAAGCCGTCGCATGTGGAATCCCTGTTATCCACCCCGAGTGGGTCCACGTTTGCGTGAAAGCTGGACACCTGATTCCTTTTG
ACAGGTACCACGTACCTTCTGGCTACTCCGTCTCCACGCGTAAATTCGAGTGTCTTCCCTCTCGAGAGGTATGGTGTATCACTATAGAGTTCATTGTTTG
TGAAACAACTGATGGCTGTATTTTTTGTGCCTAGCTACACATTTTCGAGGGATATTCCTTTGGCATCGTATGTAATGCAGAGGCAAGGGACAAGGTGGAT
TTGATGAAGTTTATCTTAGAAGCGTGCGGTGCAGATGCTGTCGATGAGGTGAGTGCTATTTTGTCTTTCTCGTGATATTAGCTGACATGATTAACGATGT
CACCTTGCATATTGTAGGATATGTCTATCAAGGGCCACAATCAAGTGGATATTGTGCTCTGCGACGAATACACAAAGGTGCATAACATGCTGTCAATTCA
CAGCGTCCTTGCCATAGCAGTACTAACATCACGAGTACTGTTGCTAGGTATGTCAATACTACAAGACGAAGCGCAATCTACCAGTTAAAGATTTCCAATG
GGTCACGGAATGTATGATCCTTCAGGTGAGCAGAAGTTACGTGCACTGCATTGGTCTGATGGCAAGTCTGATCGATGTGAGTGTGTATTTACAGCGACTC
CTAGACCCGGGCGAGCACGGCTTCGAACCACAGTGTATTGGCCGCGATAGCGTctctgcagcaagcgcagaAATCGGCGATAACGAGAAGTACGTGTACA
GCGCCTAGTGCTAACATTCTGTCTTTACTTTCTCTGAACTAAAACGTATCGTTACCTCTTTCGAACCGAACAGGACGACGCTGAAGCTATACACAGGAGA
ACTCGTGTTGGCAGACGTGTCGGGTAACGAAGTCGATCATTTCCTCATATTTAACGTGTGCGAGATCATCAGCATCCATTTGACCGGACGCAGCGATGAG
GGTTcgccgacgaagaaaaaaGGTGGAGAGGTCATGCTCCGGGTGGGCATCTTGAAACGGTACTGCATACTATCATAGACTGTACAATTGGTGCGCCCGT
AATGATTGCCATTGTTACGTGCGTGTTGACCAGAGATCCTAACTCCGCGGGTCTGTATAAGTTCCACACCCGCGTCGTGGATATCCCGGCCTCACAAGTA
AAGAGAAGAGTCGTGGCAGTCTCGAAGGAGGACTTCGACAGTATGGGCTATCGCGACGAGAGCATCTTTTACTTTGAgaatgaggacgaagacgaggacg
aagaccAATATGCCAACGATGACGTGGACCGTCAGCCATCTCAAAGACAGCGGCTAACGCAATGA