Transcript Name :
Phyke_g148
Orientation:
(+)
Number of Exons:
7
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Kinesin, motor domain1.2PR00380
Profile scan predictionP-Valprediction_id
Kinesin, motor domain51.204PS50067
HmmSmart predictionP-Valprediction_id
Kinesin, motor domain2.1SM00129
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-846
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
ATP bindingGO:0005524IEA
microtubule bindingGO:0008017IEA
microtubule motor activityGO:0003777IEA
microtubule-based movementGO:0007018IEA
*** None ***
*** None ***
Sequence
        3175 bases(100 bases per row)
ATGGCGGCGCAGGCGGCTCTAGACGTGTCCGGCAGCGTCTCCAAGCCCTCTACGCCAAGTGAACCCAGCCCTAAGACCGACTCCGTCCATGTGGCAGTAC
GCGTCCGCCCTTTAAATTCCAATGAGACCTCTCAAGGCTCAGCAACCTgtgtggacgtggtggacaaTAGCGTCTTACTTGCCGAAAAACAGTTCGACTT
TGATGCTGCATTTCCGCCTTCTACACACCAGGTTTGGCCTTCATATTCTTTTTAGACTCTATTTTATATATAAGTAATAATAGTATTgttgtgttgttgc
tcttgtGGGTGTAGGAGAGTATCTATGCGGAGCTTGTGGCGCCTATGGTCGACCAGTTCTTTGATGGATACAATGCAACAGTGTTTGCATATGGACAGAC
TGGATCCGGCAAGACGTAAGTGGTGGAGAGGTAATTTTTGCTTTTGGCAATATTTTTCATGGTGTTCTAATGATGCGGTGGTTAATGCAACAGATACACA
ATGGGCAATGAGTTCGAAACGAGTGTGGCACCGACTCAACGTGGCATCATTCCGCGTGTAATGGACGATGTATGTCGTGTGTACAAtttgtggctgcagc
aatttcaaAAGTTATTGCACAATCTGTGGAAACTCATAGATACTTTTGGTGGGCAGGTCTTCGAAAAGGTTCAAGCGAGCAAAATGGAGGGAAATATCGT
GATTAAATTGTCATACTTGGAGGTGGGGGTGGGATTTCTGCTTGatggttttgctgcagtgtctTACGGTGGTTGAATCTTTTTAGATCCTAAACGAAGA
AATTCACGACctgttggtggcgtctgAAACTGATGTACCTACGCCAGCAAGCACAGGGCTGTCAATACAAGGTGATAGTGAACGTGGCATCGTCATTTCT
GGCCTGAGTGAACACATTGTCGAATCGGTTAACCATGCCGGGCATCTCCTGCGGTCCGGTGCGTTGGTTCGGGCTACTGCTTCCACGAATATGAACTCCC
AATCCAGTCGCTCGCATGCAATTTGCACACTTACCATGAAGCAGTGTAAAGTTACTGTGGCGAGAGGAGGCACTGAAACACGATATTCCAAGTTTCACTT
GGTGGATCTAGCAGGTTCAGAGCGTGTCAAGCGTACCAATTCTCAAGGAGAGCGCTTCAAAGAAGGCGTCAATATTAACCGCGGTTTGCTTGCATTGGGA
AATGTCATTAATGCGCTGTGCGAACGCAACCGATCCAGTTCGGCAGCAACTCACGTGCCATATCGCGATTCGAAGCTGACTCGACTACTCCAGGACAGCC
TTGGCGGAAACAGCAAGACGTTGATGATCGCGTGCGCCAGTCCTGCTGATGTCAACTACGAGGAGACTTCCAACACGCTTCGCTACGCATTTCGGGCACG
TCACATTGATAATGAAGCTGTGATCAACAAAGTTAGAAATACCCAGAGCGAGGTAACGTatctcaagcagcaactaGAGATTGTACAACTGCAACTCTTA
CAACAGTCACGAGGTATACCGATGAGGATCAGAACAGAAGACTGCTTGGCAGGCGAGAAAAGCGATGTGTCACCTCTTGTGGCTGATACCCTCAGAGTGG
AAAACAGGAGATTgaaggaagagcttctcctggCAAATAATGCCAAGGACAAATGGGAAAAGATTGCAAGTGATCTGCTcaacaaaagcaaaaatCCGGC
TAATGAGCGTATAAAAGGAGAGTTATCTCGGCTAGAGCCGATCAATGTGACCCAAACGTCAACGTCTATAGCAAAGCACAACCAAGGTAGTGCAACTGGA
CAACAGTCACGCCTGGAGCAGCTTCGGAAGTTTCAAAGACAGAAGATGAAGTCGCAGCAACACAAGGAAGGTGCTGTAAAGCAGAAAGCTGATGATATCG
ACACATCAAATAAGCATAGGCGATCGCTGCTACCAAATATCCAAACCTCGGGCAGGAAAAGCTTGAGTGGAAAGAAAAACTCCTTGCTTCCTTCCCCgag
tagcagcagtcgaTCTGGCAAATTTGATACCCTATCACTGGAAGACATGAAGAGGCTTTTTCAACAAGCAATGGCATCTCAGGAGGCAATCTACGGCGCT
AAAGAGGCAATCCAGGTAAATCTAGCCGACAGGAAAACTATCGCGCTGGAGATTTCCCTCTTGGAGAATGCAACCCCTTCAGAGAAAATGATGGAGCTGA
CCAAGTTGCGGGATAATCTGAACTGCAAGACTGCTAACATTCGGCTTCTTCAACAAAAGTTAGCGAGCGTTGAGAAAAACGCATCGCTACCGTCAGGACT
TTTTCCTGTGAAAGTGGAAACTTGCCACCAGTTAATACGACACCTCATCGAGACTGCAATTGAAGGAAAAAAAGAGTGTATGGCATTGTCAAGATGTAGC
AGCGGGTTGAATACAGCACAGGAGGAGGTTGCAACTCCACGAGACACTCACAACACTGAAGTGAGCACGTTAAAAACCAAGCTTGCGGAGACCCTAACGG
AAGTGGCATTACTACGAGAGCAGGTtattgccaagaagaaatctAGAAAGCGGAAAACTCGCGAATCCTACGAAATGATCGAGATGTTATTCAGTagcag
tgacgaagaggacgataGCGGGGCTGATTCGGACTACGTGGATGAAGTAATCCGCCGACGAGAAGGGCGCAAAAAACAGAGAGGCGACCGAACGCTTGCC
CCAACATCTTCCAAATCCAAGAGCGGGGATGTGATGGAAGAAATTGACGAGTTGTTGGATACTAGCGCAGCTACCTGTTGTTCTTGCCACGGTAAATGTG
CTACGAAGGCTTGTGCTTGCAAATCGCAGGACCGCGTCTGTAGCAGCGATTGTTCGTGCAATCCGAGTAAGTGCTGCAATGCCGAAAATGATGTGATACC
AGGTTCCAATGCGCCAGGAGAAAGTGAAGCTCTCCCGAACGACGTTCTCGCTCCTTTGACTCCGACACGATCGACCACAGCTTCTACTCAGTTGGTACCA
CCCAGCGTCAACTTTTCCCCTGCATCAGCAATCGAAGAACTAACCTCTGCGAAGGAAGTCACTGCGCCTGTTACTATAGACTTGATGTCACCATGATTTT
TAATGTTACTAGTTAATCTTGTTGCTTGCCAACGAATTGGACGTGGATGCTAAACCGACGAACAGCGATGGCTAA