Transcript Name :
Phyke_g146
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein PHYSODRAFT_472499
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Potassium channel, inwardly rectifying, Kir8.3PR01320
Potassium channel, inwardly rectifying, Kir8.3PR01320
Potassium channel, inwardly rectifying, Kir8.3PR01320
Potassium channel, inwardly rectifying, Kir8.3PR01320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-98
179-699
755-760
122-155
723-736
784-971
99-121
156-178
700-722
737-754
761-783
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
inward rectifier potassium channel activityGO:0005242IEA
integral component of membraneGO:0016021IEA
potassium ion transportGO:0006813IEA
*** None ***
*** None ***
Sequence
        2916 bases(100 bases per row)
ATGCCAGCTTCCAAGAAGCGGATCCAGAACCGCGGTACACTCAACGTCGGCACACAGCAGGTGCCGGCTGAACTGCGAGATTGGGTGCACATTTGGCACG
GAGTCCGTGTCAATAATGGAGCTGAAGACACCTCTATCTTCCATACAGGGTCGAGAATCGAGGATATGCCGTTCTGGAAACAATTCATCCGACTGCCGTC
AAACTCGCTCTTCCCAAGAGTGTTTACGACTGACAATCCAAGAAAACCATACAAAGATTTCCTCTATGTGCTGCTGAATATGCGCTGGCCTATGCTGCTG
ACAGTGCTGTTGGGCGTGTTCCTGGTTAATATTTTCTTTTTCGCGGCACTCACGTGCTTTGCATGTGGAGAACCGACAAATTTCTTCGAGGCGTTTGATT
TGAGCTACCAGACTTTCACGACAATTGGCTTTGGGGTAGTGTACCCCATGCACACATGTTCGAATATAAGCATGTCGGTGGAGTCATTCGCGTCCATGAT
GATTGTGTCTGCTATCACGGGTCTGGTGTTTGCCAAGTTTGCCAAGCCGCAGGCCAAAGTAGCGTTCAGTAAAGTTTGCGTCGTGCAACCGTACGGCAAA
AAGTATTTGGCACTTGTAGTGCGGGTGGCCAATGCTACGCAGTCACGTGATGTGACCCACGATGTGATCATGGAGGCTGTATTCAAGGTCAATTTGTTGC
GGGTGGAGCACAAGACAAAGCACGTTTGGGATCACGACGAAGAGGTATCGGAAAAGAGGAGACTATCGCGTGGAGCTAGCGTTATGACGATGCAGCATGG
TGAAGATATAATGGACGAGGCCGCGTACTCGCGCACGAAAGTTCTGACGTCGTATAatctcaagctgctgcagaacaaTTTCATCACGTTCCGCATGGGC
GTAGCTGTGGTGCATGTGATCGACGAGAGCAGTCCACTTTACGGGATGTCAAAAAACGACATTGCACAGTCCGATATGCTCGTAGAGGTTGCCATGTCTG
GCGTCGACTCGACATTGCAAGACACGGTTTCTGAGCGCTACATCTATACGGCAGCCGACTTGGTGTGGGGCTACCGTTTTGCAGAATTGCTGGAGTTTAA
CGAGAGAAATGCAGAGGTCATCATGAACTTTGCGAAACTCAGTGCAGTGGATTCTGCCCCGATCGATGATGCGCGTTATCTCAAGCCCAAACTGTCCACG
GGTTTACCTTCCGACAACTACGAGAGTGCAAAGAGTGGATGCACACACGATGTGGCTCGCCGCCGCTCACATAAAAAATCGAGGGCACCTCACGACCAAG
AACAAAACCACCCATACCATGACGAGGTAGTTCATGAGGTCCCTGACGAATATTCGGAATCTTTCATGATGAGCTCGAGGTCGGATTCCTCGGATACACA
GTCATCGACGGACACCATGGAACCAGCGCAACCGCATTCTTCGGTGCTAGCACGGAGTAGAACTGGGCCTACAATATTTGCCATGGGTCTCGAGCCGCTG
TATGAGCCTTTGTTGCAGCAATCATTCGGAACGCAGCGTATTCCCaaagcttcttctgcagaaAAGCTTGCAGCCCAGAGAGGTGGTTTACGTATCTGGC
GGACCGACAGGGTGGATGGTAAAAGCGATCAGTCGGAGCTGGAGGGAGGGCATGGTAGGAATAGTGGAGGAGTACACCGGTTATctggagatgatggcgc
AAATGTTCTTGCCCGTGGTGGCAGTTCATCTAACAGTGGTAGTGAAAACGATGGTGATTCGGCGATGGTTGCAGCCCCTATCCGAGAGAAAAGACTGCTG
CAAAGAGAAATGGCAGGATCTGCCAttgtcgaagacgacacCAGCACAATCTCCCAGGATGAAGCGCACAAAGACGAACTTGATGACGAAATTGAAAGAG
ACAGTGATGCAGAGGACGACTGCGAAGATGCGGAGGCAGCTCATCAACACCGTGACCGGACGACGCTATCTGCCGTATCGATCGAGGTAGAGGATACACC
TCGCTTCTTGCGAATTTTGCCCGTACACATCCCAAAGTctttcagcttcttgcgcttttATCAGAGTGCACTCCACGTAGGCTGGCCAAAGATTACCTTC
GTGTTTGTGCTGGCGTTTGTCGTGATCAATTTCACCTTCGGGCTGTTGTATTGGCTTCACATGGGCGGTATATCGTCATATAGTGACGAAAACGTCTCGC
AATTCGAGTTGGCTTTCTATATGAGCGTTCACACGTTGGCCACTATTGGCTACGGCTCCATTGCACCAAAGCCTAAATCGGTCTACATCAACATCGTCGT
GTTCATTGAGTCGATGGTGGGGATCATCACTGTGACGATCATCACTGGCATTGCCTGGTCCAAGTTCGCCCGACCCCGGGCGCACATCCACTTTTCGTCG
AAGATGACTATCGCGACAATCTATGGCCACCGTTGCCTTGTTTTCCGTGCCGCTAACACGCGTCACTCTGGCGAAGTGCACGAGAATTTTTTCCGTATTG
GCGTGATCCTCACAAATCGACGCACGGGTTTGCGGCAGATGTACGATGTGCCCCTCGTGACTGCGGAGTGGCCGTCCATCAAGCTGCCCGCGACGCTCAT
CCACGTCATCAACGAGAACTCGCCATTCTATAAGTTCCACTCGATGAAAGAGCTCTCTCAATCGCGTGTGGCAGTCATCGCACTGTTGACTGGCCTCGAC
ACGACCTTCTCGGAAAACGTGTATGCGCGGAAAATGTACTTCTGGGATGATTTCGCGTACGACATGCGCTTCGAGGACTTTGCCGTTATCGAACGCGACC
GTGTCGTCGTGGATTACGAGCGCTTTGACCGGCTTGTCCCCGAGGACCGCGACGAAGAGGTCATGACAACGCCAGTGCTCTCAGTGAGGTCGTTGTTAGC
TGGTGACTTAGTATAG